Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RG3216 C. elegans npr-26(ve716[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 5117 bp  with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATACTTGTATCAGAATTTCCACGTGTCAGA ; Right flanking sequence: cggcgtcctggagagcccgacgccagaaat. sgRNA #1: GTTGAATCATTTTGCCATAG; sgRNA #2: ttctggtgtgtatgagtgtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CHS1065 C. elegans npr-26(yum1429) npr-27(yum1430) IV; npr-25(yum1428) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PS8442 C. elegans npr-26(sy1307) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-26. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGCCCGATGGGATTTTGTATTGTCCAAATCACAC right flanking sequence: TGGTGGTCCCGTCTGGGTACGCAATGTCTATCCAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTGTCCAAATCACACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616