| TW332 |
C. elegans |
mut-2(r459) I. Show Description
Mutator. |
|
| WM286 |
C. elegans |
mut-2(ne3370) I. Show Description
RNAi deficient. Temperature-sensitive sterile. In-frame deletion. Reference: Chen CC, et al. Curr Biol. 2005 Feb 22;15(4):378-83. |
|
| WM30 |
C. elegans |
mut-2(ne298) I. Show Description
RNAi deficient. Transposon high-hopper strain. Him. 10% dead embryos probably due to nondisjunction. |
|
| PS1678 |
C. elegans |
mut-2(?) goa-1(pk62) I. Show Description
|
|
| MT3126 |
C. elegans |
mut-2(r459) I; dpy-19(n1347) III. Show Description
Very mildly Dpy Tc1-induced dpy-19 allele. Generates severe Dpys when Tc1 hops out of dpy-19 (doesn't excise cleanly). See also WBPaper00001672. [Some concern whether the Mut phenotype in this strain is actually mut-2 because it showed no transposition of Tc3 or other Tc's besides Tc1. 1/95.] |
|
| NL1100 |
C. elegans |
mut-2(r459) I; prk-1(pk86::Tc1) III. Show Description
Insertion in CCTTCAGAAG TA TGTCATTTGG. |
|
| NL1136 |
C. elegans |
mut-2(r459) I; gpa-5(pk375) X. Show Description
|
|
| NL242 |
C. elegans |
mut-2(r459) I; flp-1(pk41::Tc1) IV. Show Description
TTTAAAACG TA CTTACCTTT |
|
| NL243 |
C. elegans |
mut-2(r459) I; ZK637.13(pk42) III. Show Description
insertion: TTCTGTGAAC TA TGTCAAAAT |
|
| NL244 |
C. elegans |
nhr-2(pk43::Tc1) mut-2(r459) I. Show Description
Dpyish. |
|
| NL245 |
C. elegans |
mut-2(r459) I; elt-2(pk46::Tc1) X. Show Description
Insertion in GGTCAAACG TA AGTTAAAGT. |
|
| NL705 |
C. elegans |
glc-2(pk55); mut-2(r459) I. Show Description
glc-2(pk55) previously called avm-2(pk55). |
|
| NL706 |
C. elegans |
mut-2(r459) cap-1(pk56::Tc1) I. Show Description
|
|
| NL708 |
C. elegans |
mut-2(r459) I; cct-1(pk58::Tc1) II. Show Description
TTCTCACA TA ATTCCGATCT. Somewhat Dpyish. |
|
| NL711 |
C. elegans |
mut-2(r459) I; feb-1(pk61). Show Description
|
|
| NL712 |
C. elegans |
mut-2(r459) I; sem-2(pk64). Show Description
|
|
| NL713 |
C. elegans |
mut-2(r459) I; sox-2(pk65). Show Description
K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT. |
|
| NL714 |
C. elegans |
mut-2(r459) I; sox-3(pk66). Show Description
F40E10.2. Location of the insertion: ATTAATAATA TA ACTATTGAAA. |
|
| NL716 |
C. elegans |
mut-2(r459) I; sod-4(pk68) III. Show Description
F55H2. |
|
| NL723 |
C. elegans |
mpk-1(pk79) mut-2(r459) I. Show Description
|
|
| NL726 |
C. elegans |
mut-2(r459) I; kin-18(pk71) III. Show Description
T17E9.1 |
|
| NL737 |
C. elegans |
mut-2(r459) I; mek-1(pk97) X. Show Description
K08A8.1 Previously called kin-17(pk97). |
|
| NL742 |
C. elegans |
rskn-1(pk209::Tc1) mut-2(r459) I. Show Description
Dpyish. Primers used to isolate pk209 are: cgatcctcgacagtttgaactgc & cgagattcagggcatgtctatgc. |
|
| CX3019 |
C. elegans |
mut-2(r459) I; dpy-19(n1347) glr-1(ky176) III. Show Description
Nose touch defective (recessive). Mechanosensory defective (semi-dominant). Mildly Dpy (ts). |
|
| CH118 |
C. elegans |
nid-1(cg118) V. Show Description
Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer. |
|
| CH119 |
C. elegans |
nid-1(cg119) V. Show Description
Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. Molecular null, deletion removes promoter region. Homozygous viable and fertile, fecundity reduced by approximately 30%. nid-1=F54F3.1. |
|
| SHG2428 |
C. elegans |
mut-2(ust447[mut-2::GFP::3xFlag]) I. Show Description
3xFlag::GFP inserted into endogenous mut-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
|