Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
MIR22 C. elegans geIs3 I; anmt-1(gk457) III. Show Description
geIs3 [sir-2.1(+) + rol-6(su1006)]. Rollers. Derived from sir-2.1-overexpressing strain GA468 crossed with 5x outcrossed anmt-1(gk457) [strain MIR16]. Reference: Schmeisser K, et al. Nat Chem Biol. 2013 Sep 29. doi: 10.1038/nchembio.1352.
MSB115 C elegans unc-70(mir6[loxP] mir16[loxP]) V. Show Description
Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987