Search Strains

More Fields
Strain Species Genotype Add
BC10518 C. elegans dpy-5(e907) I; sEx10518. Show Description
sEx10518 [rCes Y17G7B.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
RG3455 C. elegans mcm-2(ve955[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Late larval lethal. Deletion of 5085 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 animals that become increasingly unc and eventually die (ve955 homozygotes) and paralysed dpyunc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TTGACATTCTCAATTCTCAATTGCTGAGCC; Right flanking sequence: CGCGATGGAGCGCGATTGCGCGGGCATGAC. mcm-2 sgRNA A: TTTTCGATGAATTCCGACTC; mcm-2 sgRNA B: ACAGAATTCAAAAGAGGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
TG1752 C. elegans unc-119(ed3) III; gtIs63. Show Description
gtIs63 [pie-1p::GFP(lap)::mcm-2 + unc-119(+)]. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.