Search Strains

More Fields
Strain Species Genotype Add
VH7192 C. elegans coa-7 (hd7182 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ homozygotes and paralysed DpyUnc mKate2+ mnC1 homozygotes. Derived from parental strains VH7182 and CGC48. hd7182 is a 1757 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCACAACTCTGTGGAATATCCATTTCAC; Right flanking sequence: ATAGCTTCTTCGCTTATTTTTCCAGACATC. sgRNA #1: ACGCTCGAATCGCAAACTGG; sgRNA #2: GCAGGAACAGGCCGAAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.