Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
AA88 C. elegans daf-12(rh193) X. Show Description
Strong heterochronic phenotypes in seam, somatic gonad, and intestine. Heterochronic phenotypes less penetrant at 15C. Weakly daf-c at 25C. Class IV allele.
KR507 C. elegans let-549(h193) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUncLet.
OH19333 C. elegans aex-1(ot1543[aex-1::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-1 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19337 C. elegans tph-1(ot1545) II. Show Description
ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.