Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RG3320 C. elegans got-1.2(ve820[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1449 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCTTGGCGACATATTCCACGTTTTTCGTGT ; Right flanking sequence: AGGTACATCTTGTTCTTGTGGAACACCTCG. sgRNA #1: TAAGACCACAAATGTTGATG; sgRNA #2: TGACGGGAGCCGTCTCATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
ZM6660 C. elegans got-1.2(hp731) X. Show Description
got-1.2(hp731) is C184Y substitution mutation. Reference: Chitturi J, et al. PLoS Genet. 2018 Apr 12;14(4):e1007303. doi: 10.1371/journal.pgen.1007303. PMID: 29649217.