Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
AGK541 C. elegans armSi1 II; unc-119(ed3) III. Show Description
armSi1 [mex5p::unc-130::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP expression from transgene is observed in the germline. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
VC1135 C. elegans R166.3(gk541)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
R166.3. Homozygous marginally-viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk541 homozygotes (mostly sterile; some animals bear a few progeny, but a population may be difficult to maintain). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAGGAGTACACGCCGGATAA. External right primer: AGACCATTTTGCAGGATTGC. Internal left primer: AAGTGCTGACCGAAGAGCAT. Internal right primer: TGGGATTTGAAACGAGAACC. Internal WT amplicon: 1529 bp. Deletion size: 388 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4329 C. elegans tric-1B.1(gk5412[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 3742 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGGTAAGTAATTTCAAACGGTGAGATTATT; Right flanking sequence: GTCGGTCATTGGAACTCCACGAGGTCTGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4330 C. elegans igdb-1(gk5413[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 7537 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAACAGTTTCATTTTCAATTTCTTGTCCT; Right flanking sequence: TGTAATCTTATTTCTGTTCCATAGTCACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4333 C. elegans eif-4A3(gk5416[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Y65B4A.6. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 638 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAACCAGTCCACCTTTCTACGTGTATTACA. Right flanking sequence: CGGGGATGGCGCGTTGCTGGATGGCAGATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4335 C. elegans lpd-6(gk5418[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3234 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TAAATCCTCCATCACGATCTCCCGATCTTC. Right flanking sequence: CTGACGACAAGTTTTTTACCGCGATTTCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.