Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1120 C. elegans nhr-17(gk509) X. Show Description
C02B4.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4018 C. elegans ZK616.1(gk5090[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2060 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACATTTATTCCTGTTTCACTACATCATGAT ; Right flanking sequence: ACACTCCGTTTTGAACGTAGAAAAGTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4020 C. elegans R09B3.2(gk5093[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 621 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: ACCCGATATGAAGATCAACTTATTTGTTGG ; Right flanking sequence: TTTGGCCCCGCCCCTCGAATAGCATCGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4022 C. elegans lgc-6(gk5095[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATGGTTACAATAACTCCAAATACATTTATT ; Right flanking sequence: CTTCCCATAGACCTACATTCTGACACCGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4024 C. elegans lgc-13(gk5097[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2024 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATGAAAAAGATGTCTCTCCCGTGTATG ; Right flanking sequence: GCATTGGGCAATCTCATGTTTCATTTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4026 C. elegans lron-4(gk5099[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2314 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CACGTTGCTCTCACAACTTGCATTCCGCAG ; Right flanking sequence: ATTGGTTTTTATAGTTATTAGTATTACTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.