Search Strains

More Fields
Strain Species Genotype Add
VC884 C. elegans rig-6(gk376) II. Show Description
C33F10.5a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3801 C. elegans pqn-82(gk3768[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 886 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTACAGAAGTTTTAAGAAAACTGGGTCAAG; Right flanking sequence: AGGAGCAATTGGCTCAGCAGCATCACCAGC. See WormBase Variation gk3768 for details.
VC3802 C. elegans F11A10.7(gk3769[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 857 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGATCAGCCGTACTATTGATACTCTATG; Right flanking sequence: TGGACGATCATGTGATTCGTGTTGACAAAG. See WormBase Variation gk3769 for details.
VC3877 C. elegans F28C6.4(gk3758) F13D12.3(gk3757) II; Y55F3AM.9(gk3760) M7.8(gk3759) IV. Show Description
Homozygous viable. Nonsense alleles and splicing defect identified by amplicon sequencing.
VC3878 C. elegans F58H1.6(gk3761) V. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
VC3879 C. elegans pyk-1(gk3762) I; Y38H8A.12(gk3763) IV; ZC8.6(gk3764) X. Show Description
Homozygous viable. Splicing defects identified by amplicon sequencing.
VC3880 C. elegans C51E3.9(gk3766) C27A7.9(gk3765) V. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
VC3881 C. elegans str-211(gk3767) I. Show Description
Homozygous viable. Splicing defect identified by amplicon sequencing.