Search Strains

More Fields
Strain Species Genotype Add
VC879 C. elegans gly-7(gk374) V. Show Description
Y46H3A.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3784 C. elegans C50D2.5(gk3741[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 425 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTCCCTGTGGAATTTCGGAGTGTCGTTGGC; Right flanking sequence: TGGTGCTCTATTATCAAGCGACAAAAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3787 C. elegans ZK673.2(gk3749) II; gop-1(gk3747) III. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing.
VC3788 C. elegans ZK673.2(gk3749) II; lipl-5(gk3748) V. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing.