Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
GR1373 C. elegans eri-1(mg366) IV. Show Description
Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366).
RB2025 C. elegans eri-1(ok2683) IV. Show Description
T07A9.5. Homozygous. Outer Left Sequence: CCAAAGAACTTCCATCTGCC. Outer Right Sequence: TGCGGGTCATCACTAATCCT. Inner Left Sequence: TTTCGATAGGATGACGAAACG. Inner Right Sequence: GGGCTTTAACACAATTCTCCC. Inner Primer PCR Length: 1218 bp. Deletion Size: 811 bp. Deletion left flank: CCCGGAAAAAATGATTTTCTTGCGGGAAAA. Deletion right flank: TTTTCAGATTCGTCGGTTCTGGTTTCAGCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GR1379 C. elegans lin-35(n745) I; eri-1(mg366) IV. Show Description
Temperature sensitive sterile at 25C. Maintain at 15C.
KP3948 C. elegans eri-1(mg366) IV; lin-15B(n744) X. Show Description
Enhanced RNAi. Temperature sensitive sterile at 25C. Grow at 15 to 20C.
NL3630 C. elegans pkIs32 III; eri-1(mg366) IV. Show Description
pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive.
XE1057 C. elegans eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1474 C. elegans wpSi6 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi6 [dat-1p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Dopaminergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the dopaminergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1581 C. elegans wpSi10 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi10 [unc-17p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Cholinergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the cholinergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1582 C. elegans wpSi11 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi11 [eat-4p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Glutamatergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the glutamatergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1375 C. elegans wpIs36 I; wpSi1 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. GABAergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the GABAergic neurons; all other tissues are resistant to RNAi. Superficially wild type with mCherry fluorescence in the GABA motor neurons. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
LX242 C. elegans rgs-3&heri-1(vs19) II. Show Description
Healthy and appears grossly WT. This allele is a 1563 bp deletion of sequences AATTGAGTAGACAAC....GTGTCTTAAATAT. Removes almost all of the 2nd RGS domain. Previously known as cec-9.
VBS662 C. elegans nrde-2(gg95) vbaIs52 II; eri-1(mg366) IV. Show Description
vbaIs52 [eef-1A.1p::YFP::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. YFP::NRDE-3 localizes to the cytoplasm, except in the germline, early embryo, and intestine. Upon introduction of dsRNA, YFP::NRDE-3 labels transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.
VBS663 C. elegans nrde-2(gg95) vbaIs53 II; eri-1(mg366) IV. Show Description
vbaIs53 [rps-27p::mNeonGreen::Flag::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. mNG::NRDE-3 localizes to the cytoplasm. Upon introduction of dsRNA, mNG::NRDE-3 labels transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.
VBS664 C. elegans vbaIs56 I; nrde-2(gg95) vbaIs55 II; eri-1(mg366) IV. Show Description
vbaIs56 [eef-1A.1p::VenusN::nrde-3] I. vbaIs55 [eef-1A.1p::VenusC::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. N-terminal and C-terminal fragments of the fluorescent protein Venus are fused to NRDE-3 to facilitate trimolecular fluorescence complementation. In the cytoplasm or nucleus, local concentration of NRDE-3 molecules does not allow fluorescence complementation, thus reducing background fluorescence; once bound on the target transcript, VenusN::NRDE-3 and VenusC::NRDE-3 are in sufficient proximity to allow for fluorescence complementation, labeling transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.
VBS668 C. elegans nrde-2(gg95) vbaIs54 II; eri-1(mg366) IV. Show Description
vbaIs54 [eef-1A.1p::YFP::nrde-3::SL2::sid-1] II. YFP::NRDE-3 localizes to the cytoplasm in most somatic tissues and upon exposure to dsRNA targetting a gene, moves to the nucleus in cells expressing the transgene. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.
YY160 C. elegans nrde-1(gg88) III. Show Description
eri-1(mg366) has been crossed out of the background. Reference: Burkhart KB, et al. PLoS Genet. 2011 Aug;7(8):e1002249.