Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1100 C. elegans Y67D8C.5(ok1575) IV. Show Description
Y67D8C.5. Superficially wild type. External left primer: TTCTCCTGTGACAGCATTCG. External right primer: ATCTCAACAAAAGCCCGATG. Internal left primer: AACGACAGTGTGCGAACTTG. Internal right primer: TGTGCTGGGAGTATGAGCTG. Internal WT amplicon: 3242 bp. Deletion size: 1637 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
JJ1972 C. elegans eel-1(zu462) unc-33(e204) IV. Show Description
Slow growth and a maternal-effect enhancer of the efl-1(se1) embyronic lethal phenotype. Unc.
BN477 C. elegans bqSi471 II; bqSi225 IV. Show Description
bqSi471 [hsp-16.41p::FRT::mCherry::his-58::FRT::peel-1 + unc-119(+)] II; bqSi225 [emr-1p::emr-1::mCherry + unc-119(+)] IV. Expression of emr-1p::emr-1::mCherry marker is visible, but faint. Suitable for spatiotemporal cell ablation by crossing with FLP-expressing strains.
EG4348 C. elegans C. elegans wild isolate. Show Description
Utah natural isolate carrying peel-1(qq99) I. EG4348 was collected by M. Ailion from Salt Lake City, UT. qq99 designates the naturally occurring nonsense mutation in peel-1. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
EG5389 C. elegans oxIs494 II; unc-119(ed3) III. Show Description
oxIs494 [peel-1p::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. GFP is expressed in the spermatogenic germline. During spermatogenesis, GFP remains in the residual body and is not packaged into sperm. Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
EG5767 C. elegans qqIr7 I; oxSi78 II; unc-119(ed3) III. Show Description
qqIr7 [peel-1(qq99)] I. oxSi78 [peel-1p::peel-1 (introns included)::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. Genetic background is a mixture of N2 and wild isolate EG4348. The oxSi78 insertion produces a PEEL-1::GFP translational fusion. PEEL-1::GFP is expressed in the spermatogenic germline and packaged into sperm. PEEL-1::GFP appears to localize to fibrous body-membranous organelles. PEEL-1::GFP does not rescue peel-1(qq99). Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
EG5801 C. elegans oxSi87 II; unc-119(ed3) III. Show Description
oxSi87 [peel-1p::N-terminal 12 amino acids of PEEL-1::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. GFP is expressed in the spermatogenic germline. During spermatogenesis, GFP is packaged into sperm. Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
EG7566 C. elegans unc-119(ed3) III; oxTi211 V. Show Description
oxTi211 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.
EG7916 C. elegans unc-119(ed3) III; oxTi208 IV. Show Description
oxTi208 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.
EG7952 C. elegans unc-119(ed3) III; oxTi207 V. Show Description
oxTi207 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.
GLW8 C. elegans eel-1(utx8[mNG::eel-1]) IV. Show Description
Slow growing. N-terminal tag of EEL-1 via CRISPR/Cas9 knock-in of mNeonGreen at eel-1 locus. Insertion verified by PCR. Left flank: 5' gacaagcgggttttttgaatcgtttcgaaa 3'; Right flank: 5' ATGAAGATTGACGATGCTGAGCCGAGCTCTAGTTCATCGGGCTCCGATAT 3' (6 silent mutations). sgRNA: 5' GACCCGGAAGAGCTTGAACT 3'
PX631 C. elegans fxSi3 I; fxSi4 II; fog-2(q71) V. Show Description
fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605
PX658 C. elegans fxSi1 I; fxSi4 II; fxSi6 III; spe-44(fx123[spe-44::AID*]) IV; fog-2(fx111) V. Show Description
fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605
QX1409 C. elegans qqIR7 (I: peel-1(qq99), EG4348>N2); ttTi5605 II; unc-119(ed3) III. Show Description
Nonsense allele of peel-1 carried in Utah isolate EG4348 crossed into N2 Bristol background. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115.
VC2388 C. elegans zeel-1(ok2484) I. Show Description
Y39G10AR.5. External left primer: GCTGAATTCTCCGGCTTAAA. External right primer: TAGCCAGAGCCCGTGTAAGT. Internal left primer: CATCAAGATAAACCGGCAAA. Internal right primer: CACGTTTCGAGGTGTCGTTA. Internal WT amplicon: 1126 bp. Deletion size: 767 bp. Deletion left flank: AAGAAGATTTCTCAGAACTCTGCGATTCCT. Deletion right flank: AGAAAGGTTTATTTTTTGAAAAGTTAACGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
EG5897 C. elegans oxSi120 II; unc-119(ed3) III. Show Description
oxSi120 [peel-1p::tagRFP::msp-142 3'UTR + unc-119(+)]. Reference: Batchelder EL, et al. Proc Natl Acad Sci U S A. 2011 Jul 12;108(28):11429-34.
JUP1 C. elegans oxSi120 II; him-8(e1489) IV. Show Description
oxSi120 [peel-1p::tagRFP::MSP-142 3'utr+ unc-119(+)]. Him. Derived from EG5897 and CB1489; not known if is unc-119(ed3) is still present in background. Reference: Batchelder EL, et al. Proc Natl Acad Sci U S A. 2011 Jul 12;108(28):11429-34.
UX993 C. elegans jnSi12 II; ezIs2 III; ltIs37 IV. Show Description
jnSi12 [peel-1p::htas-1::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)] II. ezIs2 [fkh-6::GFP + unc-119(+)] III. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP expression in spermatheca. mCherry expression in germline nuclei. UX993 sperm have increased mCherry intensity compared to that of its parent strains. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]