Search Strains

wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. GFP expression in seam cells and adherens junctions. ajm-1 previously called jam-1.

jjIs1089 [npp-1::GFP + unc-119(+)]. Reference: J Cell Sci. 2009 Jun 15;122(Pt 12):1970-8.

qyIs366 [ser-2(prom3)::hpo-30::GFP + unc-119(+)] V. Reporter allows visualization of HPO-30 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.

qyIs368 [ser-2(prom3)::dma-1::GFP + unc-119(+)] I. Reporter allows visualization of DMA-1 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.

qyIs10 [lam-1p::lam-1::GFP + unc-119(+)]. Reference: Ziel JW, et al. Nat Cell Biol. 2009 Feb;11(2):183-9.

qyIs552 [lin-29p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of ratiometric ATP:ADP biosensor PercevalHR.

qyIs553 [lin-29p::ceGreenGlifon4000 +unc-119(+)]. Superficially wild-type strain expressing green glucose biosensor in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. Anchor cell specific red F-actin marker. mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.

qyIs570 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)] X. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP.

qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR.

qyIs552 [lin-29p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of ratiometric ATP:ADP biosensor PercevalHR. netrin null mutant background (ev400).

qySi313 [lin-29p::ucp-4::SL2::mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR] I. qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR. Anchor cell specific overexpression of mitochondrial uncoupling protein, UCP-4, (expression confirmed by presence of red anchor cell membrane). qySi313 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.

qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP in netrin null mutant background (ev400).

qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.

qyIs43 [pat-3::GFP + ina-1(genomic) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: Hagedorn et al., Dev Cell (2009) Aug 17(2):187-98.

qyEx78 [Venus::unc-6(deltaSP) + unc-119(+)]. Maintain by picking non-Unc.

qyIs102 [fos-1ap::rde-1(genomic) + myo-2::YFP + unc-119(+)]. Uterine-specific RNAi.

qyIs108 [lam-1p::lam-1::Dendra + unc-119(+)]. High expression in basement membranes; cleaner laminin-dendra expression than NK652. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.

qyIs109 [lam-1p::lam-1::Dendra + unc-119(+)]. High expression in basement membranes, also accumulates in body wall muscle. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.

qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.

qyIs138 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.

qyIs139 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.

qyEx115 [C11D9.1::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx114 [C28C12.10::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx116 [C14A11.3b::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx117 [C14A11.3a,c::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx118 [exc-5::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx121 [F55C7.7d::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx120 [F55C7.7c::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx119 [F13E6.6::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx122 [F55C7.7e::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx123 [K07D4.7a::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx124 [pix-1::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx125 [R02F2.2::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx126 [T19E10.1::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx127 [ced-5::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyEx128 [F22G12.5::GFP + unc-119(+)]. Maintain by picking non-Unc.

qyIs161 [emb-9p::emb-9::Dendra + unc-119(+)]. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.

qyIs174 [hlh-2p::GFP::hlh-2 + unc-119(+)]. Translational fusion protein displaying cytoplasmic and nuclear localization; contains 8 kb upstream, N-terminal GFP fusion, full open reading frame and 3'UTR. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91.

qyIs176 [zmp-1(50-51)p::mCherry::moeABD + unc-119(+)]. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91.

syIs51[cdh-3::CFP + unc-119(+)] V. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC.

syIs52[cdh-3::cfp + unc-119(+)] X. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC.

syIs54 [ceh-2::GFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC.

syIs57 [cdh-3::CFP + unc-119(+)]. Unsure if unc-119(ed4) remains in the background. Do not distribute this strain; other labs should request it from the CGC.

syIs60 [F47B8.6::GFP + unc-119(+)] II. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC.

syIs65 [pT100.18(B0034.1::pes-10::GFP) + unc-119(+)] IV. unc-119(ed4) may have been crossed out. Do not distribute this strain; other labs should request it from the CGC.

syIs66 [B0034.1::pes-10::GFP + unc-119(+)] II. Expressed in vulE and vulF. Do not distribute this strain; other labs should request it from the CGC.

syIs68 [zmp-1::pes-10::CFP + unc-119(+)] IV. Expressed in vulA and vulE. Do not distribute this strain; other labs should request it from the CGC.

syIs75 [lin-18::GFP + unc-119(+)].

syIs101[T04B2.6::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC.