Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CB934 C. elegans sma-1(e934) V. Show Description
Short, round-headed, especially in early larvae. Adults have slight rolling tendency. Males can mate.
RG3434 C. elegans gsto-2(ve934[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGTGCAATTTGTCATCATGTAGGCTTCCG ; Right flanking sequence: TGGATTGTAAATATCTTCTCTTCGTTACAA. gsto-2 sgRNA A: GGGAAGGAAGTAAACACAGG; gsto-2 sgRNA B: GGAGCACCAAACTTTGACTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.