Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CB843 C. elegans unc-54(e843) I. Show Description
Stiff. Body muscle abnormal.
RG3343 C. elegans marc-5(ve843[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 6603 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. This indel also deletes tRNA Y57A10B.t1. Left flanking Sequence: GGGTAAGAAGGACCATAAGCCTACTCGAGC ; Right flanking sequence: CTGATGCTGCAAAAATTAGAAAAAATACGT. marc-5 sgRNA #1: ACAATCACAGAACTCCGCAG; marc-5 sgRNA #2: TATTTGTCTCAACAACGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW1523 C. elegans unc-87(e843) unc-54(s95) I. Show Description
Unc. unc-87 affects muscle thin filaments. unc-54(s95) is a missense myosin heavy chain mutation that assembles properly but does not function well in contraction.