Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CB719 C. elegans unc-1(e719) X. Show Description
Unc: recessive kinker.
JT10066 C. elegans unc-1(e719) pdk-1(sa680) X. Show Description
Unc. Daf-c at 25C. Egl, Clumpy, Lon, low brood size. Dauers do not recover when moved to 15C in the presence of food. Daf-c, Lon, Clumpy and fertility defects can be rescued maternally. Maintain at 15C.
PJ1162 C. elegans ccIs55 V; unc-1(e719) pdk-1(sa680) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc - recessive kinker. Daf-c at 25C. Egl, Clumpy, Lon, low brood size. Dauers do not recover when moved to 15C in the presence of food. Daf-c, Lon, Clumpy, and fertility defects can be rescued maternally.
RG3219 C. elegans C25H3.7(ve719[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2210 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaatcagtcgtctacaacacatcttcttg ; Right flanking sequence: CGGACTGCATtctgaaagagaaaaaatata. sgRNA #1: tatTCAATCGTCTCTCCACT; sgRNA #2: AGTTTTACCCAAGTTGAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.