Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields
Strain Species Genotype Add
CB1026 C. elegans lin-1(e1026) IV. Show Description
Multi-vulva (Muv).
CF32 C. elegans lin-1(e1026) IV; him-5(e1490) V. Show Description
Very slow growth.
RG3526 C. elegans glct-2(ve1026[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 2023 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCACGGTCGAAAAGCTTCAATCCCTCACCT ; Right flanking sequence: GGTGGATTTGTCTAACCGAAAATTCACAAC. glct-2 crRNA A: GGTTTCAGAACACTCATCGT; glct-2 crRNA B: ATTCTGATTGTCCATTcacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
XE1026 C. elegans sup-17(n316) I; oxIs12. Show Description
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. Neuron. 2012 Jan 26;73(2):268-78.