| CL2166 |
C. elegans |
dvIs19 III. Show Description
dvIs19 [(pAF15)gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP.
|
|
| VP596 |
C. elegans |
dvIs19 III; vsIs33 V. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. vsIs33 [dop-3::RFP] V. References: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166. Leung CK, et al. J Vis Exp. 2011 May 19;(51).
|
|
| QV224 |
C. elegans |
dvIs19 III; skn-1(zj15) IV. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.
|
|
| SPC167 |
C. elegans |
dvIs19 III; skn-1(lax120) IV. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.
|
|
| SPC168 |
C. elegans |
dvIs19 III; skn-1(lax188) IV. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.
|
|
| CL691 |
C. elegans |
dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.
|
|
| CL6180 |
C. elegans |
smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CYA19 |
C. elegans |
dvIs19 III; rexEx11. Show Description
dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.
|
|
| CYA20 |
C. elegans |
dvIs19 III; rexEx12. Show Description
dvIs19 [gst-4p::GFP::NLS] III. rexEx12 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of mCherry::Halo protein. Oxidative stress induces expression of GFP.
|
|
| CYA21 |
C. elegans |
dvIs19 III; rexEx13. Show Description
dvIs19 [gst-4p::GFP::NLS] III. rexEx13 [hsp-16p::HA::wdr-23::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of HA::WDR23::Halo protein. Oxidative stress induces expression of GFP.
|
|