| VC49 |
C. elegans |
cyb-1(gk35)/mIs11 IV. Show Description
ZC168.4. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] IV. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP (strong signal represents mIs11 homozygotes, weaker signal represents gk35/mIs11) and non-GFP gk35 homozygotes that generally develop into sterile adults. Sterility seems to be male-rescuable. GFP may be seen in early embryos (4-cell onward) and gut. Pick fertile WT to maintain, but check for proper segregation of gk35 steriles. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC50 |
C. elegans |
cyb-1(gk35) IV/nT1 (IV;V). Show Description
ZC168.4. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk35 hermaphrodites (sterile). Sterility seems to be male-rescuable. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| DG4569 |
C. elegans |
cyb-1(tn1806[cyb-1::gfp::tev::3xflag]) IV. Show Description
Viable and fertile, grows and moves well. No apparent abnormalities yet noted. Reference: Spike CA, et al. Genetics. 2022 May 5;221(1):iyac051.
doi: 10.1093/genetics/iyac051. PMID: 35377419
|
|
| ET113 |
C. elegans |
unc-119(ed3) III; ekIs2. Show Description
ekIs2 contains [pie-1p::GFP::cyb-1 + unc-119(+)]. Translational fusion of CYB-1 expressed from the pie-1 promoter and including the pie-1 3'UTR. GFP::CYB-1 expression in the proximal gonad, with staining disappearing in the zygote. Maintain at 25°C.
|
|
| OD2653 |
C. elegans |
ltSi1112 I; unc-119(ed3) III. Show Description
ltSi1112 [cyb-1p::cyb-1::mNeongreen::cyb-1 3'UTR + Cbr-unc-119(+)] I. CYB-1::mNG reporter using its own promoter and UTR. Single-copy transgene insertion in Chromosome I using MosSCI. Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
|
|
| OD3913 |
C. elegans |
cyb-1(lt125[cyb-1::LAP::mNG::loxP::3xFlag]) IV. Show Description
mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
|
|
| WS2072 |
C. elegans |
opIs76 I; unc-119(ed3) III. Show Description
opIs76 [cyb-1p::cyb-1::YFP + unc-119(+)]. The fusion protein partially rescues a cyb-1 null allele, so it is at least partially functional. non-Unc strain.
|
|