| JDW699 |
C. elegans |
col-14(wrd271[col-14::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-14 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| RG3465 |
C. elegans |
col-14(ve965[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1019 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATATTCAAACTTTGGAATCTCAAGTTCA ; Right flanking sequence: aggataattttgatttgtatacttacgttt. Note that col-14 resides in the 6th intron of C46A5.4 and it is not known whether this indel alters its expression. col-14 sgRNA A: ACTTGATCTTGAATTCTGCC; col-14 sgRNA B: tgtttgtatcgaaaatctgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4094 |
C. elegans |
col-141(gk5185) V. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5185 mutation is T->G, flanking sequences GATGATCTTCAACGACATCAACTCATTCTA and GATGAAAAGATTGAGGAGCTCAATGAGTTC.
|
|
| VH7018 |
C. elegans |
col-144(hd7006[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAACATATACATAGGTTACTACGATCCCA; Right flanking sequence: AGTAAGGTCATTCTGCGTCTCTCTTCATTT. sgRNA #1: AGAACCGCAATTACGATTAT; sgRNA #2: CAAAAGAATCTGCCGATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|