Search Strains

More Fields
Strain Species Genotype Add
VC4426 C. elegans cal-2(gk5504[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1512 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGTTCGGTTGTTGGTGAAGCTGCTGAGCCA; Right flanking sequence: GATGAGAGCGAGTAAGCTCCGTTGGAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
KRA584 C. elegans pha-1(e2123) III; kasEx273. Show Description
kasEx273 [cal-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with cal-2 genomic region (-3,326 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.