Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1793 C. elegans cTe154X.1(gk3143) III; ZK185.2(gk804) IV. Show Description
This strain is homozygous for a deletion (gk804) in ZK185.2, detectable by PCR using the following primers. External left primer: AACCAAACGATGTCCCTGAC. External right primer: TCGGAAATGAAAACCCCATA. Internal left primer: TATTAGAGGCATATCGGCGG. Internal right primer: ATCACACCGGCGAGAATTAG. Internal WT amplicon: 1842 bp. Deletion size: 780 bp. Deletion left flank: ACTTGAATTTTTCCAGTAATTTTAGTTTTG. Deletion right flank: CTCTACCGGAGTTTGAAGGCACTTATTCGT. Validation: No CGH probes for gk804. Other deletion (gk3143) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1749 C. elegans ZK185.2(gk828) F55G11.8(gk3130) IV. Show Description
This strain is homozygous for a deletion (gk828) in ZK185.2, detectable by PCR using the following primers. External left primer: AACCAAACGATGTCCCTGAC. External right primer: TCGGAAATGAAAACCCCATA. Internal left primer: TATTAGAGGCATATCGGCGG. Internal right primer: ATCACACCGGCGAGAATTAG. Internal WT amplicon: 1842 bp. Deletion size: 1014 bp. Deletion left flank: TTAAAGAATAAATATTTCATTTGGAAGCTC. Deletion right flank: AGGGGCGCGTTAAGAAATCTTGGGTCTTTA. Validation: No CGH probes for gk828. Other deletion (gk3130) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
OP474 C. elegans unc-119(tm4063) III; wgIs474. Show Description
wgIs474 [ZK185.1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
RW10741 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10651. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10651 [ZK185.1::H1-wCherry + unc-119(+)].
SD1645 C. elegans ccIs4251 I; stIs10617. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10617 [ZK185.1p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
VC2319 C. elegans ZK185.1(gk3229) IV. Show Description
ZK185.1. Homozygous viable deletion, detectable by nested PCR. External left primer: TCCAAGTCAGCGCCTCTTAT. External right primer: AATTCAGCGAAAATGATCCG. Internal left primer: TTGGCGATGAACGTACCATA. Internal right primer: AATCGTGTAGCTGGTGGAGG. Internal WT amplicon: 1766 bp. Deletion size: 472 bp. Deletion left flank: TTCACAAAAAGTTAGATAAAAAGGTTGTGC. Deletion right flank: CAGCTAGTTTTTGTGCATTTTCTCAGATGT. Insertion sequence at break: GGCTAGTTTTTGTG. Validation: gk3229 confirmed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3979 C. elegans ZK185.5(gk5056[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 4521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCGTTTACTTTTCTTGGTTTAATCACTTT; Right flanking sequence: CGCCTGATAATCTTCTAAAACTTTGAACAG. See WormBase Variation gk5056 for details.
VC4357 C. elegans ZK185.3(gk5440[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2074 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTTTTCTCCGTGTACCTCTTTGTACCAATG; Right flanking sequence: GGCGGCTGAATGCGATCTTTTCCAATTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.