Search Strains

More Fields
Strain Species Genotype Add
RB2318 C. elegans Y43F8B.2(ok3150) V. Show Description
Y43F8B.2 Homozygous. Outer Left Sequence: tcacaacccggtgactgata. Outer Right Sequence: ctgtgacctttcggaccatt. Inner Left Sequence: gggtcaatagctggtgtgct. Inner Right Sequence: cacttctcctgttccccaaa. Inner Primer PCR Length: 1176. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
DM7160 C. elegans pha-1(e2123) III; raEx160. Show Description
raEx160 [T05G5.1p::Y43F8B.2(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
VC4379 C. elegans Y43F8B.22(gk5460[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 697 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATTATCAACGAAAAATCTTCACAGTTCCA; Right flanking sequence: AGAACTAAGATAAGTGCTATTCCATCAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.