Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC4273 C. elegans F59E12.1(gk5356[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1652 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ACTCTTGTTCTTCCTCCAACCAAGCCTCCC; Right flanking sequence: TTGGGTGAAGCAACATACGATCAAGGAGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RB1063 C. elegans fut-3(ok1013) II. Show Description
F59E12.13 Homozygous. Outer Left Sequence: GAAAGTTCCAATGGGCTCAA. Outer Right Sequence: TCAACATTTTGAGCAGACGC. Inner Left Sequence: TCGTTGTCAAACCATTTCCA. Inner Right Sequence: TTGAAACCGCCAAGTGATTT. Inner Primer PCR Length: 3345. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC182 C. elegans fut-3(gk103) II. Show Description
F59E12.13. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2193 C. elegans ddl-1(ok2916) II. Show Description
F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGA TTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGT GTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807