Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RG3097 C. elegans F20A1.1(ve597[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 544 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: actaatcaccactacgtgtcgtcacaattc ; Right flanking sequence: aagactacagtaacgggtgaaatatcgaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
PHX6670 C. elegans spig-2(syb6670[spig-2::SL2::GFP::H2B]) V. Show Description
SL2::GFP::H2B cassette inserted directly before the stop codon of the endogenous spig-2 locus. spig-2 also known as txt-17 or F20A1.10. Reference: Aguilar GR & Hobert O. (2024). A protocol to transform a fluorescent reporter from a nuclear to a cytoplasmic location. microPublication Biology. https://doi.org/10.17912/micropub.biology.000954
RG3098 C. elegans F20A1.10(ve598[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgtatatatgtgcatttcgagcaacaaca ; Right flanking sequence: cggtttttatacatccaaattgagatcggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.