Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC4240 C. elegans F07H5.13(gk5324[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 537 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTAAATTCATAATTTTCAGATGTAAATCCA; Right flanking sequence: TTTTATGCATTCTCTCTCTTCCTTCTTCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.