Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
HBR3216 C. elegans lgc-38(goe13[flp-11p::XCaMP-R::flp-11 3’UTR] *syb2346) III; flp-11(syb6321[flp-11::sfGFP] *syb714) X. Show Description
sfGFP tag inserted at C-terminus of endogenous flp-11 locus. FLP-11sfGFP translational reporter is visible in RIS and together with XCaMP-R allows visualization of RIS activity and FLP-11 release. [syb6321 sgRNA1: GCTACCATAGGCACCACGAGCGG.] [goe13 dpy-10 crRNA: Gctaccataggcaccacgag. trRNA: aacagcauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.] Reference: Park B, et al. Sci Adv. DOI: 10.1126/sciadv.adv8387 PMID: