Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RW12299 C. elegans C34D10.2(st12299[C34D10.2::TY1::EGFP::3xFLAG]) X. Show Description
eGFP and 3xFLAG tags inserted into endogenous locus by CRISPR/Cas9.
VC4042 C. elegans C34D10.2(gk5116[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 6402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCGATTATTTTCAACGCTGGCCAACCGCCG ; Right flanking sequence: CTCGTCAACTCATCTTCTACCAAATTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.