Search Strains

More Fields
Strain Species Genotype Add
AA86 C. elegans daf-12(rh61rh411) X. Show Description
Daf-d, weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.
OD63 C. elegans unc-119(ed3) III; ltIs43/+. Show Description
ltIs43[pAA26; pie-1::GFP-TEV-STag::ZEN-4; unc-119(+)]. Insertion only viable when heterozygous. Pick non-Unc worms to maintain.
RG3381 C. elegans Y38C1AA.6(ve881[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 851 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTGAACAATGTTTCGATCAAAAACATTCCC ; Right flanking sequence: CGGTGTTGGAGTGTTTCAATGAAGATGATG. Y38C1AA.6 sgRNA #1: GTTGCAAATTGGGCATGAAG; Y38C1AA.6 sgRNA #2: AGATTTCCAACTTATTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.