| RB2312 |
C. elegans |
F40B5.1(ok3144) X. Show Description
F40B5.1 Homozygous. Outer Left Sequence: taaatttcgagagccggatg. Outer Right Sequence: acgctttgtgcaagagtgtg. Inner Left Sequence: atggaggataacgcaaggaa. Inner Right Sequence: gaaagaggtgagcctggaga. Inner Primer PCR Length: 1192. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2313 |
C. elegans |
F40B5.1(ok3145) X. Show Description
F40B5.1 Homozygous. Outer Left Sequence: taaatttcgagagccggatg. Outer Right Sequence: acgctttgtgcaagagtgtg. Inner Left Sequence: atggaggataacgcaaggaa. Inner Right Sequence: gaaagaggtgagcctggaga. Inner Primer PCR Length: 1192. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2314 |
C. elegans |
Y42H9AR.1(ok3146) IV. Show Description
Y42H9AR.1 Homozygous. Outer Left Sequence: tcagtaaatcgcaggcagtg. Outer Right Sequence: gttggtgctgaagttgcaga. Inner Left Sequence: ttgtgccatctcaaaattgg. Inner Right Sequence: cgtaggatacgacggtggag. Inner Primer PCR Length: 1166. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2315 |
C. elegans |
T27A8.1(ok3147) X. Show Description
T27A8.1 Homozygous. Outer Left Sequence: atgctaatccggcacttcac. Outer Right Sequence: atctttattgcgttggtcgg. Inner Left Sequence: aaagaaggagaagtctcgacca. Inner Right Sequence: atgccccctaattttatgcc. Inner Primer PCR Length: 1177. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2316 |
C. elegans |
str-2(ok3148) V. Show Description
C50C10.7 Homozygous. Outer Left Sequence: tcgacctgtcaaacatcgaa. Outer Right Sequence: cgcatttgtgaacctgtttg. Inner Left Sequence: aaatcctcgtcgataacttttga . Inner Right Sequence: gcacacatatgggtctgcttt. Inner Primer PCR Length: 1212. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2317 |
C. elegans |
T13C5.5(ok3149) X. Show Description
T13C5.5 Homozygous. Outer Left Sequence: gcgctatggttcttgaaagc. Outer Right Sequence: ccggtttgcaaggtttagtc. Inner Left Sequence: ttgtaacaaaaattgccccc. Inner Right Sequence: gatttgaatggcgatcttgag. Inner Primer PCR Length: 1279. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2318 |
C. elegans |
Y43F8B.2(ok3150) V. Show Description
Y43F8B.2 Homozygous. Outer Left Sequence: tcacaacccggtgactgata. Outer Right Sequence: ctgtgacctttcggaccatt. Inner Left Sequence: gggtcaatagctggtgtgct. Inner Right Sequence: cacttctcctgttccccaaa. Inner Primer PCR Length: 1176. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2320 |
C. elegans |
F07A11.4(ok3152) II. Show Description
F07A11.4. Homozygous. Outer Left Sequence: GCAGACCGAGAAGAGAAGGA. Outer Right Sequence: CAAAAATTTCATCCGGCCTA. Inner Left Sequence: CAAGGAATGGATGCAAAAGG. Inner Right Sequence: TTTCCATGCTTCATTCGACA. Inner Primer PCR Length: 1095 bp. Deletion Size: 681 bp. Deletion left flank: ACGCGCAGACCGAGAAGAGAAGGATCGAGA. Deletion right flank: CAAGGCTACACTGGTCTCCGAAACATTGGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2321 |
C. elegans |
K02F3.6(ok3153) III. Show Description
K02F3.6 Homozygous. Outer Left Sequence: aattttgaaatttgccgcac. Outer Right Sequence: gttcaacgatgcgagatcaa. Inner Left Sequence: gttcaacgatgcgagatcaa. Inner Right Sequence: tatccatttcaacgagggga. Inner Primer PCR Length: 1282. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2322 |
C. elegans |
K05F1.6(ok3154) II. Show Description
K05F1.6 Homozygous. Outer Left Sequence: atcaatgctcggagtgttcc. Outer Right Sequence: tccggtagtggcttctcact. Inner Left Sequence: tgtgcatggaaatcacaggt. Inner Right Sequence: ttctggtaatacgaacaccaaca. Inner Primer PCR Length: 1188. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2324 |
C. elegans |
T05C12.1(ok3156) II. Show Description
T05C12.1 Homozygous. Outer Left Sequence: ttcccgagtatagtcccgtg. Outer Right Sequence: catgtggattgattgtccca. Inner Left Sequence: caagcaaaacggtcatcaga. Inner Right Sequence: tgctcatcttgtttctttcatttt. Inner Primer PCR Length: 1143. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2325 |
C. elegans |
Y74C9A.5(ok3157) I. Show Description
Y74C9A.5 Homozygous. Outer Left Sequence: cgaatccttaaatcctggca. Outer Right Sequence: aattctgccaactccaatgc. Inner Left Sequence: gtggatagcaagctgccagt. Inner Right Sequence: gccgtcggaataatgtcaat. Inner Primer PCR Length: 1202. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2326 |
C. elegans |
clec-230(ok3158) V. Show Description
C29F3.5. Homozygous. Outer Left Sequence: CGTTCAACTCACCAGATCCA. Outer Right Sequence: TTCGCGCCAAGTCTAATTTT. Inner Left Sequence: CTGCCCAGTCAAAATCACATT. Inner Right Sequence: AGGAGTGATGGACCAATTTTT. Inner Primer PCR Length: 1299 bp. Deletion Size: 367 bp. Deletion left flank: GTCAGCGGCCTTTAAGATTTCTAGCATTTG. Deletion right flank: TTGTCATTGGAGACACCGTTTTGCCAGACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2327 |
C. elegans |
cex-1(ok3163) II. Show Description
F56D1.6. Homozygous. Outer Left Sequence: AGCTCCTACCCCGTTCTGAC. Outer Right Sequence: ATGCTCAAGCACATCTGGTG. Inner Left Sequence: TCAGAATTTCTTGGGTTCATCA. Inner Right Sequence: TGGAAAGTGAAGGGTTTTCAG. Inner Primer PCR Length: 1173 bp. Deletion Size: 678 bp. Deletion left flank: CGCAAGGAGGAGCTATGATCATCACAAAAG. Deletion right flank: TATACCGATGGAATGAGTACATATGGATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2328 |
C. elegans |
set-8(ok3164) X. Show Description
F02D10.7. Homozygous. Outer Left Sequence: ACGATGGATGCATGATGTGT. Outer Right Sequence: TCTCTTCCACGATTGCTGTG. Inner Left Sequence: TGTTTTACGGAAGGATTTGAAAG. Inner Right Sequence: CAATTGGGCTCACAAGACG. Inner Primer PCR Length: 1299 bp. Deletion Size: 487 bp. Deletion left flank: CACAATCAAGGAGCTCCTTTGTCATGACGA. Deletion right flank: TATGTAACAGACATTTTTATGGATACTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2329 |
C. elegans |
D2092.5(ok3165) I. Show Description
D2092.5. Homozygous. Outer Left Sequence: TGGCAGAATGTTGATGTGGT. Outer Right Sequence: TGGTGATAAAAAGAACGGGC. Inner Left Sequence: CAGAAGCAGTCTGAAACGGA. Inner Right Sequence: AACGAAAGGACGAGCGAATA. Inner Primer PCR Length: 1264 bp. Deletion Size: 972 bp. Deletion left flank: TGAACTCGTCGCTCCAATGATTTGATAGTG. Deletion right flank: CTGTTTCTGTTGTTTTTGTGAATTATTATT. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2330 |
C. elegans |
PDB1.1(ok3166) X. Show Description
PDB1.1. Homozygous. Outer Left Sequence: TGTGTTCGTTTCAGTCTCGC. Outer Right Sequence: ATGAAAACCAAAATGCGCTC. Inner Left Sequence: ACGGAATATGCTCCCTGATG. Inner Right Sequence: GCCCACAAAGAAGATATGCAA. Inner Primer PCR Length: 1114 bp. Deletion Size: 343 bp. Deletion left flank: TTCGCTGAAATATCATTCATTTAGAATGTA. Deletion right flank: GATGTTACCGTAAACGCGCTATCAGAATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2331 |
C. elegans |
bre-4(ok3167) I. Show Description
Y73E7A.7. Homozygous. Outer Left Sequence: CTCTGTCCCCCATTTTCTCA. Outer Right Sequence: TTCCATATTCGGCGATCTTC. Inner Left Sequence: AGAACCCTCCGAAAAATCGT. Inner Right Sequence: CGGAATCAGTGCACTAACAAA. Inner Primer PCR Length: 1315 bp. Deletion Size: 496 bp. Deletion left flank: TTTTTTTCAAAAATCAATAAAAGTCATCGA. Deletion right flank: AATCATTTTATATCGTGCAATTTGTGTCGG. Insertion Sequence: AGTCATCGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2332 |
C. elegans |
try-4(ok3168) V. Show Description
F31D4.6. Homozygous. Outer Left Sequence: GGACTAACGGTTCGGACAAA. Outer Right Sequence: TTTCTCCACTGGCGCTATTC. Inner Left Sequence: CAATGGGCTCAAATGAACAA. Inner Right Sequence: TGAGTCGGGATTCCTTCTTT. Inner Primer PCR Length: 1248 bp. Deletion Size: 666 bp. Deletion left flank: CTTAATGTGTAATAGAAAAAGTGTAATATT. Deletion right flank: ACATGTTAGGGCGTGGAAGACAAATTGGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2333 |
C. elegans |
Y106G6H.14(ok3169) I. Show Description
Y106G6H.14. Homozygous. Outer Left Sequence: CAGCATCCGAGTCTGACAAA. Outer Right Sequence: GACCGTCTTCGTCCATCATT. Inner Left Sequence: TTCAGCATACTCTTCTTCATTCAC. Inner Right Sequence: GCGGACCGTTGACTTTCTAT. Inner Primer PCR Length: 1296 bp. Deletion Size: 381 bp. Deletion left flank: GCTGTAAGTATTCACCATAATTAGCTGGAA. Deletion right flank: CCGTTTATTAGCTATTTGACAGAGAAATTT. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2334 |
C. elegans |
T03D8.6(ok3170) V. Show Description
T03D8.6. Homozygous. Outer Left Sequence: TTTTTCGACGATTGAGCCTT. Outer Right Sequence: TACGCGCAGAAGAATTTGTG. Inner Left Sequence: CAGTCATTCTATCAATAACCCATTG. Inner Right Sequence: CGAAAATTGGAGGGTAAGCA. Inner Primer PCR Length: 1214 bp. Deletion Size: 689 bp. Deletion left flank: CTCCGTGATAGAAAAGTTGAACTGGGTTTG. Deletion right flank: AATAAACACACAGCAATTAGCTGAAAAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2335 |
C. elegans |
ivns-1(ok3171) X. Show Description
R09A8.3. Homozygous. Outer Left Sequence: CAAAGCAACACCAAAGCAAA. Outer Right Sequence: AAAAGACGTGGCGAAAGCTA. Inner Left Sequence: GCCATTGAGACGAAGGACTG. Inner Right Sequence: GCGTCTCGTCTTCCAAACAT. Inner Primer PCR Length: 1120 bp. Deletion Size: 643 bp. Deletion left flank: GCCATGCATTGGTTTTTGGATCGAATGCTT. Deletion right flank: CTCGTTGTCCGTAAGCTGAAGGCTAAGCAC. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2336 |
C. elegans |
F13H8.9(ok3172) II. Show Description
F13H8.9. Homozygous. Outer Left Sequence: TCTCAATCGGTGATGATGGA. Outer Right Sequence: AAGGCTGCTGATGCAATTCT. Inner Left Sequence: TCTTCTTAAGACGGGGAGCA. Inner Right Sequence: GAAGCAAGAAGTCATCTCGGA. Inner Primer PCR Length: 1198 bp. Deletion Size: 754 bp. Deletion left flank: CCACACTTGATGTATTTGGAAGTCTCTGGG. Deletion right flank: GAAGTTTTGAAACTTTCTTAGCATTTCTTA. Insertion Sequence: TGCTCGATATTTGTAGTGATAATATGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2337 |
C. elegans |
nas-18(ok3173) V. Show Description
K03B8.3. Homozygous. Outer Left Sequence: GGAGGAGCCAACTACCGAGT. Outer Right Sequence: CAGCCGAACAATAACTGCAA. Inner Left Sequence: TTGCTTTGATTCTTCATTCAGTAA. Inner Right Sequence: CCAATGGCAATCCAGTATCC. Inner Primer PCR Length: 1190 bp. Deletion Size: 724 bp. Deletion left flank: AAGTTCTATTATATTTTGAAGTAGTGAAAT. Deletion right flank: GCATAATTATGCAATTTTCAACCAATCTAC. Insertion Sequence: TGAAGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2338 |
C. elegans |
T23G5.6(ok3174) III. Show Description
T23G5.6. Homozygous. Outer Left Sequence: AGAAATGGATGGAAGCAACG. Outer Right Sequence: TAGGTGAGGGAAGTGCTGCT. Inner Left Sequence: AAACATTGCCCTGCAAAAAG. Inner Right Sequence: GCGATGCGATTTAGAGCAAT. Inner Primer PCR Length: 1281 bp. Deletion Size: 891 bp. Deletion left flank: ACGTGATAAAAAGGAACAAAATGGATATGG. Deletion right flank: GATGACAAAAATATTCTACATGAGCAAAAT. Insertion Sequence: ATATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2339 |
C. elegans |
F53H8.3(ok3175) X. Show Description
F53H8.3. Homozygous. Outer Left Sequence: GCGGTACCAGTTTCGTTCTT. Outer Right Sequence: CTCCTCCACGTCCAATCAAT. Inner Left Sequence: GCAATCAACCAGTACAAAAGTAGAA. Inner Right Sequence: GGAAATGGCGAAATTGAAAA. Inner Primer PCR Length: 1370 bp. Deletion Size: 622 bp. Deletion left flank: GAAAGGAGCAAGCACCTCACATGTTTGAGT. Deletion right flank: TGCAGAATTACGAAAATGTGAGTTTTGAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2341 |
C. elegans |
ubc-16(ok3177) I. Show Description
Y54E5B.4. Homozygous. Outer Left Sequence: AAGTTGTCGGAATTGGTTGG. Outer Right Sequence: TTGCGATTCGAAGAGAGCTT. Inner Left Sequence: CATTGTTCAATATGCACCCAA. Inner Right Sequence: TGGCCACAAAGAAGAAAAGG. Inner Primer PCR Length: 1138 bp. Deletion Size: 551 bp. Deletion left flank: TAAACACAATTTTTTTTCAGACGACAGTGT. Deletion right flank: GTGGGCGGCAAACGATTTTCCCGGAAAAAC. Insertion Sequence: ACAGTACCCACATTTGATAATATTTCGATACAAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2342 |
C. elegans |
adm-2(ok3178) X. Show Description
C04A11.4. Homozygous. Outer Left Sequence: GGGAGATCAAATTTCGGTGA. Outer Right Sequence: CGATTGGCGGAAATTCTAAA. Inner Left Sequence: TCCAGATTCAAAAGAGACGTTG. Inner Right Sequence: CCACTGAGCGTAGTCCACCT. Inner Primer PCR Length: 1253 bp. Deletion Size: 989 bp. Deletion left flank: CTTGATGACGTGGGTGTTCCTATACAAAAA. Deletion right flank: TTTGTATAAAAATAGAGAAAAATATCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2343 |
C. elegans |
try-13(ok3179) V. Show Description
F25E5.7. Homozygous. Outer Left Sequence: TTCGGCAATATGCCCTTAAC. Outer Right Sequence: CGCGGCTGAAGACTTTAGTT. Inner Left Sequence: CCTTTCCTCCAACGAAGAATC. Inner Right Sequence: TGACATTGCATACCAGGAGAA. Inner Primer PCR Length: 1222 bp. Deletion Size: 631 bp. Deletion left flank: TTTCAGTATTACGTTCAAAAAGATGGGAAA. Deletion right flank: GAACATGAACTGCAATGCGAATCCACAGAA. Insertion Sequence: AAAAAAACATTTTGATTAATTTCAGAATTTTGATAAATTTCAAAACATTTGATTAATTT CAGTATGACTCCGGAGGTAGTGCAATAAGCAACGTTTCCGGACAAAATACCGTTCTTGG AGTGTATGTAACAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2344 |
C. elegans |
C49C3(ok3180) IV. Show Description
C49C3. Homozygous. Outer Left Sequence: TCCCTTAAAACGTGCAATGA. Outer Right Sequence: CCAAATTCCTCCTGTTTGGA. Inner Left Sequence: TCAATTCAGTGCATGCTTCA. Inner Right Sequence: CTTCTTCAGCAAACGAAGCC. Inner Primer PCR Length: 1310 bp. Deletion Size: 281 bp. Deletion left flank: AAAAAAGAAAAAGAAAGTTCGAAAATGTGT. Deletion right flank: AAAGAGTAATTTTTTCGAAATTTGAAATCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2345 |
C. elegans |
clec-29(ok3181) V. Show Description
T25E12.9. Homozygous. Outer Left Sequence: CTGGAGGGAGACCAAATTGA. Outer Right Sequence: ATTTTCTAGCAAGGCAGCCA. Inner Left Sequence: TGCAAATGAACCAACTCCTG. Inner Right Sequence: CTGCAAACCATGACAACTTCA. Inner Primer PCR Length: 1140 bp. Deletion Size: 549 bp. Deletion left flank: AGAGTGTCAGCACGAATCGGTTCTCGTTTC. Deletion right flank: GTGTAGATCCACCGAGGTTCATGCAAGCCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2346 |
C. elegans |
prkl-1(ok3182) IV. Show Description
ZK381.5. Homozygous. Outer Left Sequence: TCGGGATACCCAGTAAGCAG. Outer Right Sequence: CCTCCAATTGTGCTTCTTCG. Inner Left Sequence: AATAGTCTCCCAGGGCCAAG. Inner Right Sequence: CACGTTCACAATTGTAATTCTCGT. Inner Primer PCR Length: 1264 bp. Deletion Size: 649 bp. Deletion left flank: TCCATAATAACAAGAGTTGAAAAAGCAAAT. Deletion right flank: TTTCGGGTTTAAATTGTATACCTCTGCATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2347 |
C. elegans |
idh-2(ok3183) X. Show Description
C34F6.8. Homozygous. Outer Left Sequence: TTCAAGTTTGCAGGTCACCA. Outer Right Sequence: GGTTCCCTTCTTGGTTCCAT. Inner Left Sequence: CCCATGCAATTCTTGAGCAC. Inner Right Sequence: TTTTTCCCTCCTCGACAGTG. Inner Primer PCR Length: 1324 bp. Deletion Size: 597 bp. Deletion left flank: GAACTACGACGGAGATGTGCAAAGTGACAT. Deletion right flank: GCATTGACACTGTCGAGGAGGGAAAAATGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2348 |
C. elegans |
idh-2(ok3184) X. Show Description
C34F6.8. Homozygous. Outer Left Sequence: TTCAAGTTTGCAGGTCACCA. Outer Right Sequence: GGTTCCCTTCTTGGTTCCAT. Inner Left Sequence: CCCATGCAATTCTTGAGCAC. Inner Right Sequence: TTTTTCCCTCCTCGACAGTG. Inner Primer PCR Length: 1324 bp. Deletion Size: 716 bp. Deletion left flank: TCCAATACGCATTGATGAAGCAATGGCCAC. Deletion right flank: CTGTGGGCAACTTTCACAACAATTAAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2349 |
C. elegans |
pgp-3(ok3187) X. Show Description
ZK455.7. Homozygous. Outer Left Sequence: GCGAATGCTCTTATGGAAGG. Outer Right Sequence: TTGCAAATGAACTCGTGAGC. Inner Left Sequence: CGTTATGCGAACGACGACTA. Inner Right Sequence: ATTCGGATGTTTTCAGCGAC. Inner Primer PCR Length: 1151 bp. Deletion Size: 573 bp. Deletion left flank: CCGGTGGAATGGCAAATGAAGTAATTGCTG. Deletion right flank: CAAGCATTGGACTTTTGATGAGATTTTATA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2350 |
C. elegans |
clec-43(ok3188) II. Show Description
R07C3.1. Homozygous. Outer Left Sequence: ATGCAAGTTATGTGTGCGGA. Outer Right Sequence: GTTATTTGGAGAGGCTGCCA. Inner Left Sequence: TTTTGTGGGCCTGAGTTTTT. Inner Right Sequence: GCCGCATTATACATTCGGATA. Inner Primer PCR Length: 1270 bp. Deletion Size: 706 bp. Deletion left flank: TCCTCAGATGGAGATTATTCCTACTACAGC. Deletion right flank: ATAAGATCTATAACTCTACTACAAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2352 |
C. elegans |
C29F3.5(ok3190) V. Show Description
C29F3.5 Homozygous. Outer Left Sequence: cgttcaactcaccagatcca. Outer Right Sequence: ttcgcgccaagtctaatttt. Inner Left Sequence: ctgcccagtcaaaatcacatt. Inner Right Sequence: aggagtgatggaccaattttt. Inner Primer PCR Length: 1298. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2353 |
C. elegans |
Y110A7A.20(ok3191) I. Show Description
Y110A7A.20 Homozygous. Outer Left Sequence: gaatcaacaaatgcagtgcg. Outer Right Sequence: tgaaaacagaaccatcgtcg. Inner Left Sequence: tccaaccaaaaattgcttca. Inner Right Sequence: aaatgctcaaaagaatcccg. Inner Primer PCR Length: 1223. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2354 |
C. elegans |
F15D4.4(ok3200) II. Show Description
F15D4.4 Homozygous. Outer Left Sequence: ggtagatttaaagcgcgtcg. Outer Right Sequence: ttccggaaatatgcaggaag. Inner Left Sequence: agcgcgaaaaattcaatgag. Inner Right Sequence: gttcaattccggcagtttg. Inner Primer PCR Length: 1171. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2355 |
C. elegans |
lev-1(ok3201) IV. Show Description
F09E8.7 Homozygous. Outer Left Sequence: atcgattgctcgttgagctt. Outer Right Sequence: gctcgactttctcacttcgg. Inner Left Sequence: gctcatcatccagctcatca. Inner Right Sequence: ccgtgtcgatttttcggaat. Inner Primer PCR Length: 1300. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2356 |
C. elegans |
C24B9.9(ok3202) V. Show Description
C24B9.9 Homozygous. Outer Left Sequence: ttatttctgggctcgcattc. Outer Right Sequence: agtagttgcggctgagttcc. Inner Left Sequence: ggtcgaagtgatacctgtgga. Inner Right Sequence: tgacattttgaagcaaatcaatg. Inner Primer PCR Length: 1238. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2357 |
C. elegans |
F41H10.6(ok3203) IV. Show Description
F41H10.6 Homozygous. Outer Left Sequence: ggggtgatttcgggtctaat. Outer Right Sequence: tccaacactcatcggattca. Inner Left Sequence: agtgaagtccgagacggaaa. Inner Right Sequence: agtatgcccaacacatccg. Inner Primer PCR Length: 1139. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2358 |
C. elegans |
Y54G2A.25(ok3204) IV. Show Description
Y54G2A.25 Homozygous. Outer Left Sequence: gcatcgcaaacgagacataa. Outer Right Sequence: cttaggcattaggcaggcag. Inner Left Sequence: atgcgcactgtagttggtga. Inner Right Sequence: acaagtcaagcgtgtaggca. Inner Primer PCR Length: 1151. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2359 |
C. elegans |
Y54G2A.25(ok3205) IV. Show Description
Y54G2A.25 Homozygous. Outer Left Sequence: gcatcgcaaacgagacataa. Outer Right Sequence: cttaggcattaggcaggcag. Inner Left Sequence: atgcgcactgtagttggtga. Inner Right Sequence: acaagtcaagcgtgtaggca. Inner Primer PCR Length: 1151. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2360 |
C. elegans |
ZC477.2(ok3206) IV. Show Description
ZC477.2 Homozygous. Outer Left Sequence: agtgaatgaaggagcggaaa. Outer Right Sequence: cttgtaggcatgaaggggaa. Inner Left Sequence: tcctcgatcgattgaatgc. Inner Right Sequence: acgccggaacttctgactct. Inner Primer PCR Length: 1236. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2361 |
C. elegans |
nas-24(ok3207) V. Show Description
F20G2.4 Homozygous. Outer Left Sequence: ggagtggttcagctggagag. Outer Right Sequence: aaaacgattgcagaaaacgg. Inner Left Sequence: atggagactggatggtgtgc. Inner Right Sequence: caatgatggttgggttgtga. Inner Primer PCR Length: 1114. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2362 |
C. elegans |
abf-5(ok3208) X. Show Description
T22H6.5 Homozygous. Outer Left Sequence: gagatgagtcaggaccgagc. Outer Right Sequence: atcccattgcctcaccaata. Inner Left Sequence: ctgccactattgtcacaaaatct. Inner Right Sequence: gccaactctttctcagcacc. Inner Primer PCR Length: 1198. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2363 |
C. elegans |
Y51H4A.13(ok3209) IV. Show Description
Y51H4A.13 Homozygous. Outer Left Sequence: aagccagtagatgtcgggtg. Outer Right Sequence: gccagaaccctgtgaatgat. Inner Left Sequence: tacagcgtccgacatctcac. Inner Right Sequence: tcgaattttcgacaaatcaataa. Inner Primer PCR Length: 1264. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2364 |
C. elegans |
D2023.6(ok3210) V. Show Description
D2023.6 Homozygous. Outer Left Sequence: tgtcaacggaggtgttttca. Outer Right Sequence: actatctgaacggcgaatgg. Inner Left Sequence: aacacatttcgggaatggaa. Inner Right Sequence: aaaaacggcagaaagaccaa. Inner Primer PCR Length: 1204. Deletion size: about 700bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2365 |
C. elegans |
vit-2(ok3211) X. Show Description
C42D8.2 Homozygous. Outer Left Sequence: atggagcacgctcttgctat. Outer Right Sequence: tgggatctttccagagatgg. Inner Left Sequence: tcacatggaaaacgaggaca. Inner Right Sequence: gctcttggttgagaagacgg. Inner Primer PCR Length: 1222. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|