| RB2155 |
C. elegans |
Y71D11A.5(ok2900) III. Show Description
Y71D11A.5 Homozygous. Outer Left Sequence: ccagtttcagctgtgtcgaa. Outer Right Sequence: gttttgcacgtacttccacg. Inner Left Sequence: aaactaggcttgttgggggt. Inner Right Sequence: cgaagctaataatggtgccaa. Inner Primer PCR Length: 1313. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2156 |
C. elegans |
R02F11.1(ok2901) V. Show Description
R02F11.1 Homozygous. Outer Left Sequence: atgaagcaactcgccatctc. Outer Right Sequence: agaaagactgggggcaattt. Inner Left Sequence: atccgactttcagctccaga. Inner Right Sequence: aggtgtatccagttgggcag. Inner Primer PCR Length: 1108. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2157 |
C. elegans |
cdh-12(ok2902) III. Show Description
Y71D11A.1 Homozygous. Outer Left Sequence: atggccgagtacaccttcac. Outer Right Sequence: ccagagtcctgagcttccac. Inner Left Sequence: attccgcaaaactccacg. Inner Right Sequence: aggatcgtaacgttcaaccg. Inner Primer PCR Length: 1102. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2158 |
C. elegans |
Y41E3.3(ok2918) IV. Show Description
Y41E3.3 Homozygous. Outer Left Sequence: ctcggcacatatttcggttt. Outer Right Sequence: atatgcccagtcaactccca. Inner Left Sequence: gaaattttcccgaactttcaa. Inner Right Sequence: aaaaagtttcccaaaaaccg. Inner Primer PCR Length: 1098. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2159 |
C. elegans |
ins-16(ok2919) III. Show Description
Y39A3A.5 Homozygous. Outer Left Sequence: gagcgcgtaaatcttagcca. Outer Right Sequence: ttaattccggcaaagtaccg. Inner Left Sequence: gtctgaaccttggtcaagca. Inner Right Sequence: ggaaaatttcaatttcggca. Inner Primer PCR Length: 1191. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2160 |
C. elegans |
cdh-10(ok2920) IV. Show Description
C45G7.5 Homozygous. Outer Left Sequence: acctcaaatccccgatcttt. Outer Right Sequence: taggccaccaacttcaatcc. Inner Left Sequence: tcaaaaaccgtggtgatcatt. Inner Right Sequence: cccactctgcagttttcaca. Inner Primer PCR Length: 1163. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2161 |
C. elegans |
ZK858.6(ok2921) I. Show Description
ZK858.6 Homozygous. Outer Left Sequence: agttcgatgaacatggctcc. Outer Right Sequence: cgacaatttgccagttgcta. Inner Left Sequence: ctccagcgatgagtgaactg. Inner Right Sequence: ctgttatcaatccagcgcaa. Inner Primer PCR Length: 1327. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2162 |
C. elegans |
C18H9.8(ok2922) II. Show Description
C18H9.8 Homozygous. Outer Left Sequence: gatgcctgtgtcaagagctg. Outer Right Sequence: ccacttcaaccttgccaact. Inner Left Sequence: ggacctccaagagcacctact. Inner Right Sequence: acgcacaattccatgaagaa. Inner Primer PCR Length: 1309. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2163 |
C. elegans |
hmit-1.1(ok2923) V. Show Description
Y51A2D.4 Homozygous. Outer Left Sequence: aaggccgttttagtccgaat. Outer Right Sequence: tatttgtgcatgagcccgta. Inner Left Sequence: tttggatttccaggttctcg. Inner Right Sequence: atcaaagcctgctggaagac. Inner Primer PCR Length: 1151. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2164 |
C. elegans |
T04D3.3(ok2924) I. Show Description
T04D3.3 Homozygous. Outer Left Sequence: tctcacagttcacctgacgc. Outer Right Sequence: cggaagttttggctagcagt. Inner Left Sequence: ttcaaggataaatttgccgc. Inner Right Sequence: agggtcactgcatttttcca. Inner Primer PCR Length: 1290. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2165 |
C. elegans |
C06E7.1(ok2932) IV. Show Description
C06E7.1 Homozygous. Outer Left Sequence: gttctcgtccgaaacgtcat. Outer Right Sequence: gaaattggggaggaatttgg. Inner Left Sequence: tgcaatgttcttgttgcactc. Inner Right Sequence: ggatatcgaggatattgcgg. Inner Primer PCR Length: 1179. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2166 |
C. elegans |
his-70(ok2933) III. Show Description
E03A3.4 Homozygous. Outer Left Sequence: tccgtaaactttaggccacg. Outer Right Sequence: tgttcattgaaatcaccgga. Inner Left Sequence: ccatccactgcagacacagt. Inner Right Sequence: acgtttttgaacgaaatggg. Inner Primer PCR Length: 1316. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2167 |
C. elegans |
secs-1(ok2934) V. Show Description
D1054.13 Homozygous. Outer Left Sequence: accttgccagcgtcataatc. Outer Right Sequence: cacgcagtgaaatcttgcat. Inner Left Sequence: aaatgattcgttgatcggga. Inner Right Sequence: tgttgtacccctttgcactg. Inner Primer PCR Length: 1121. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2168 |
C. elegans |
ZK1240.2(ok2935) II. Show Description
ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2169 |
C. elegans |
F29G6.3(ok2936) X. Show Description
F29G6.3 Homozygous. Outer Left Sequence: tgtggtgctcatgcttcttc. Outer Right Sequence: tcacacacctacaggtccca. Inner Left Sequence: ctcaaactttctgcgaaggg. Inner Right Sequence: tccgctttgactcatgacag. Inner Primer PCR Length: 1207. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2170 |
C. elegans |
clc-11(ok2937) V. Show Description
F44G3.10. Homozygous. Outer Left Sequence: TAGCACACAAGGTGGCACTC. Outer Right Sequence: AAAACTCCCAACTCTTCGCA. Inner Left Sequence: CTCACATCCCAGGAAGCATT. Inner Right Sequence: AACGTTTTTGCTGACACACG. Inner Primer PCR Length: 1145 bp. Deletion Size: 664 bp. Deletion left flank: AGTAATAATAAGAATTTAATAAACGAGTAA. Deletion right flank: AACGATTCCAACGCTGCCTCCATCATCCGT. Insertion Sequence: AACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2171 |
C. elegans |
Y4C6A.1(ok2938) IV. Show Description
Y4C6A.1. Homozygous. Outer Left Sequence: GAAAACTCCAAACGGGACAA. Outer Right Sequence: ATTCGGCATACCTTCAAACG. Inner Left Sequence: AAATCAAAAGCCGTTCGTG. Inner Right Sequence: CCCCAACTGAAAATGGCTTA. Inner Primer PCR Length: 1236 bp. Deletion Size: 408 bp. Deletion left flank: CTGTTCAAGTGCAACTTTTCAACTTCTGAA. Deletion right flank: CTGTATTCATCGGTTCGTTTTCTTAAAAAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2172 |
C. elegans |
ttr-30(ok2939) X. Show Description
T08A9.2. Homozygous. Outer Left Sequence: TAGCGGTGACTCAACGGATT. Outer Right Sequence: AGAAACACGAGTCCCGAGAA. Inner Left Sequence: AAAACGAAGTCACATCATTGAAAA. Inner Right Sequence: CGTGGTTTTTGATAGGAGTACCA. Inner Primer PCR Length: 1116 bp. Deletion Size: 501 bp. Deletion left flank: GAAACATTTGCTATAAAACTTCTCGTCCTC. Deletion right flank: AATCTTCAATCGGTTTCTGTGAACGGAACA. Insertion Sequence: AGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2173 |
C. elegans |
F12D9.1(ok2940) X. Show Description
F12D9.1. Homozygous. Outer Left Sequence: TAATGTGGTCCGCACAAAAA. Outer Right Sequence: GAGCAAAGTTGCGATTGTGA. Inner Left Sequence: TTTACTTGTGCATTTTTCCCA. Inner Right Sequence: TAGCGCAGCGTAGTTGGATA. Inner Primer PCR Length: 1192 bp. Deletion Size: 543 bp. Deletion left flank: ACGCGGCCACATTCTTCCCAGTCACGTTTT. Deletion right flank: TTTCAGATGCTGTAATTAGGATTTAGTTGA. Insertion Sequence: TTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2174 |
C. elegans |
F59D6.7(ok2941) V. Show Description
F59D6.7. Homozygous. Outer Left Sequence: ACGGGCAAATTCCACATATT. Outer Right Sequence: AATACAAAACGGTATGCGCC. Inner Left Sequence: TTCATACATTTGATTGGTGTACTAA. Inner Right Sequence: AAATGCACACGTGGGGTTAG. Inner Primer PCR Length: 1297 bp. Deletion Size: 570 bp. Deletion left flank: TAGAAATTAATTCAAAAATCGCATCGACAT. Deletion right flank: CTGGGACATTCAAGAAGTCGTCACGTGACA. Insertion Sequence: CATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2175 |
C. elegans |
klp-20(ok2942) III. Show Description
Y50D7A.6. Homozygous. Outer Left Sequence: ATCACAACGGGAATCTGGAG. Outer Right Sequence: TTCAACGGCAAAAATGTTCA. Inner Left Sequence: GAATTTGGAATCCTCCCGAT. Inner Right Sequence: TCATATTTCTCACCTCAATTTCTCA. Inner Primer PCR Length: 1133 bp. Deletion Size: 588 bp. Deletion left flank: CAAGGAGAGCGGTTGAAGGAGGCGGCGAAG. Deletion right flank: CAAATCGTGCGAAGAATATTCAAAACGTCG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2176 |
C. elegans |
gly-4(ok2943) V. Show Description
Y116F11B.12. Homozygous. Outer Left Sequence: TGACACCAGATTTGACGGAA. Outer Right Sequence: CAAAAACCTCCGAAGCACAT. Inner Left Sequence: AAATTTTGCTTTTTGGGCCT. Inner Right Sequence: CCAAATTTTGCGACTTACTATCG. Inner Primer PCR Length: 1177 bp. Deletion Size: 617 bp. Deletion left flank: ATCATCACGGCACAATGAGAAAAGTTGCTC. Deletion right flank: ATTAGATGTCGATAGTAAGTCGCAAAATTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2177 |
C. elegans |
hlh-11(ok2944) III. Show Description
F58A4.7. Homozygous. Outer Left Sequence: AAGCTTGCGTCTTGAGAAGG. Outer Right Sequence: AAACTTGGCAATGTTGGAGG. Inner Left Sequence: GAGGAGATGATGAGTTCGGG. Inner Right Sequence: GGAATATACGTTGAGACGCCA. Inner Primer PCR Length: 1099 bp. Deletion Size: 432 bp. Deletion left flank: GGACACAAAGGAGAAGATATACCTGACGGT. Deletion right flank: CACATTGCCATCTTCATATGCTTCATCGGC. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2178 |
C. elegans |
sre-48(ok2945) II. Show Description
Y39G8B.3. Homozygous. Outer Left Sequence: AGGTGCACACCTTTTTGCAT. Outer Right Sequence: ACCTTTTGGAAAAATTGCGA. Inner Left Sequence: AGCGACTGGGTGAAACAGAA. Inner Right Sequence: GCACCTGAATAATGCGAAAAA. Inner Primer PCR Length: 1272 bp. Deletion Size: 508 bp. Deletion left flank: GTCTCTGTCTCCTTTTTCAGCTCTTCGCAC. Deletion right flank: AGAATTTTCTAGAATTTTCCAAAAGGTTTC. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2179 |
C. elegans |
F59A3.10(ok2955) I. Show Description
F59A3.10 Homozygous. Outer Left Sequence: ttgccgaaaataagtttgcc. Outer Right Sequence: ttagtgtcgtcagtggggaa. Inner Left Sequence: acggctatttcctctgaacg. Inner Right Sequence: tcaaaatgggtcaaaaagaaaaa. Inner Primer PCR Length: 1236. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2180 |
C. elegans |
W07B8.1(ok2956) V. Show Description
W07B8.1. Homozygous. Outer Left Sequence: TGTGGGAATTTGCCAAAACT. Outer Right Sequence: GTCGACCTGTTGCGACCTAT. Inner Left Sequence: GGCCGGAAATTATTAGGTCA. Inner Right Sequence: ACTTTCAGCCACTTTCGTCG. Inner Primer PCR Length: 1352 bp. Deletion Size: 561 bp. Deletion left flank: CACGGTATTCCTACCGGAGGATCCTATGAA. Deletion right flank: AACTTCCAGTTATTGCAAAAGAAAAACGGA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2181 |
C. elegans |
ZK643.3(ok2957) III. Show Description
ZK643.3. Homozygous. Outer Left Sequence: AACTCGCAAAGCTCCAAAAA. Outer Right Sequence: TCGCTTCAAGACCCAGTACC. Inner Left Sequence: CTATTCTAACGGCTCGCCAA. Inner Right Sequence: CCGATCCATTTCAATTTGCT. Inner Primer PCR Length: 1177 bp. Deletion Size: 534 bp. Deletion left flank: CTCATCTCATGTCTCTTATACGGAGCATTC. Deletion right flank: ATAGAATTCCAAGCATTGGATAATGATTAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2182 |
C. elegans |
ZK632.3(ok2958) III. Show Description
ZK632.3. Homozygous. Outer Left Sequence: CGCTCATCGTCAGTGAAAAA. Outer Right Sequence: GTCAGTTTTGCGGATGTCCT. Inner Left Sequence: CCCATTCCACGTTTTTGAGT. Inner Right Sequence: ACTTGCTCTTCAACGCCATT. Inner Primer PCR Length: 1108 bp. Deletion Size: 371 bp. Deletion left flank: GCCGACCATATCGCCTGTTGGAAGGGTGTT. Deletion right flank: AAGACGAGAATTCGTTGCATTTTCCTCATC. Insertion Sequence: TCCCTTCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2183 |
C. elegans |
grl-16(ok2959) I. Show Description
Y65B4BR.6. Homozygous. Outer Left Sequence: AACTGAAGTGTGGGTGAGGG. Outer Right Sequence: TCATTCGGAAATGAACACGA. Inner Left Sequence: GGAGTGGTGCGAATCTGACT. Inner Right Sequence: CTTCCCCCTATTCTGCAACA. Inner Primer PCR Length: 1236 bp. Deletion Size: 473 bp. Deletion left flank: TCCGGCGTTGTAGCCTCCTTGTGGGGCGAC. Deletion right flank: AAGTAGAATGGACTTTGTCGCTCCTTAAGG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2184 |
C. elegans |
clc-32(ok2960) V. Show Description
F10A3.1. Homozygous. Outer Left Sequence: TGCGGACTGCAAATAAAGTG. Outer Right Sequence: CGTGTGCTTTGTACGCTGAT. Inner Left Sequence: TCCCGTTTCTACTTGGTTTTT. Inner Right Sequence: TTCCGAAACAAAATGCACAA. Inner Primer PCR Length: 1208 bp. Deletion Size: 327 bp. Deletion left flank: TTCAGGGTAAGCACTAAATTGAGTTCCGTG. Deletion right flank: GTGTGTAAGCAAGTGCGTTATGAAATTGTG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2185 |
C. elegans |
glt-4(ok2961) X. Show Description
T22E5.2. Homozygous. Outer Left Sequence: GCCTCATTGGATTCTGGAAC. Outer Right Sequence: TTTTATCGGATTACGGCGAG. Inner Left Sequence: GCAGGAAGATTAGGAATGGTG. Inner Right Sequence: GCCAAAAAGCTCAAAATTGG. Inner Primer PCR Length: 1130 bp. Deletion Size: 343 bp. Deletion left flank: ATCGGATGGGTCATTATGTAATATTGAAAT. Deletion right flank: TTAATCTTGACTCGAATCGAGAATGATAGG. Insertion Sequence: TTAATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2186 |
C. elegans |
H25K10.5(ok2962) IV. Show Description
H25K10.5. Homozygous. Outer Left Sequence: TGGGCCCTAACGCATACTAC. Outer Right Sequence: CCGGTTGTACAGCCCTACTC. Inner Left Sequence: CGGTTATCTAGGTGTGGCCT. Inner Right Sequence: AGGCGAAACTCACTACATCCA. Inner Primer PCR Length: 1227 bp. Deletion Size: 570 bp. Deletion left flank: TGATAAAACTCACTTCCACACTTTCGAGCC. Deletion right flank: TGTCACATAGAAAACGAAAGTATAATCCTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2187 |
C. elegans |
lgc-47(ok2963) X. Show Description
F47A4.1. Homozygous. Outer Left Sequence: GCCCGAAGAAGATTACCAAA. Outer Right Sequence: ACGACCCAACGAACAGAAAC. Inner Left Sequence: TCCTTTCATTCTTTTGCTCACA. Inner Right Sequence: AAGCGGAAAGTGTTTCTCCTC. Inner Primer PCR Length: 1179 bp. Deletion Size: 521 bp. Deletion left flank: GTCATATAGGTTGGAATGTAACCTTGCAAG. Deletion right flank: TACTAAAGTTTGTCATTGTGAAATCAGGTA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2188 |
C. elegans |
flp-20(ok2964) X. Show Description
E01H11.3 Homozygous. Outer Left Sequence: ccgattgccaaaacgattac. Outer Right Sequence: agcccgcttccttcatagtt. Inner Left Sequence: tcatgaagctatcggaagatca. Inner Right Sequence: tcctccatcaccagacaaca. Inner Primer PCR Length: 1194. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2189 |
C. elegans |
Y41E3.3(ok2969) IV. Show Description
Y41E3.3 Homozygous. Outer Left Sequence: ctcggcacatatttcggttt. Outer Right Sequence: atatgcccagtcaactccca. Inner Left Sequence: gaaattttcccgaactttcaa. Inner Right Sequence: aaaaagtttcccaaaaaccg. Inner Primer PCR Length: 1098. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2191 |
C. elegans |
C35D10.11(ok2971) III. Show Description
C35D10.11 Homozygous. Outer Left Sequence: ttacatgggtgcaaatgtcg. Outer Right Sequence: ataccccaacataatgccca. Inner Left Sequence: ttcagcttctccgccactac. Inner Right Sequence: caactgaacacgtcattgtgg. Inner Primer PCR Length: 1257. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2192 |
C. elegans |
grd-10(ok2972) IV. Show Description
F09D12.1 Homozygous. Outer Left Sequence: tcgtcatctttttgtcgctg. Outer Right Sequence: attgaaccaatagttgcggg. Inner Left Sequence: ttcttgtgttccaaaagggc. Inner Right Sequence: ttgagatagggtaaaagaagatcg. Inner Primer PCR Length: 1202. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2193 |
C. elegans |
F44G3.2(ok2973) V. Show Description
F44G3.2 Homozygous. Outer Left Sequence: tgcacagattggtcttcgac. Outer Right Sequence: aggtccaaatgatgtcagcc. Inner Left Sequence: tttcaactctgtgtcttggca. Inner Right Sequence: ccgcattattcgttaagggt. Inner Primer PCR Length: 1144. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2194 |
C. elegans |
math-33(ok2974) V. Show Description
H19N07.2 Homozygous. Outer Left Sequence: gaaagttcgcggactgaatc. Outer Right Sequence: cttgtcggtcattgtgtcgt. Inner Left Sequence: cgtgcattcgaagcttacac. Inner Right Sequence: cgaaaaatagaaggtcccct. Inner Primer PCR Length: 1180. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2195 |
C. elegans |
C16E9.2(ok2975) X. Show Description
C16E9.2 Homozygous. Outer Left Sequence: tgttgctgaagcaattcgac. Outer Right Sequence: ccccctttgaaaacaagaca. Inner Left Sequence: gttggcaacacagcaaggta. Inner Right Sequence: cagctcgttctcctcgtttc. Inner Primer PCR Length: 1373. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2196 |
C. elegans |
K08D10.14(ok2976) IV. Show Description
K08D10.14 Homozygous. Outer Left Sequence: aatttagcgtacgccactcg. Outer Right Sequence: aggagaatgtggtaaggcga. Inner Left Sequence: agcacgcgctttgtgttt. Inner Right Sequence: agaccaaattctgtgggtgtg. Inner Primer PCR Length: 1275. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2197 |
C. elegans |
srw-99(ok2977) V. Show Description
Y46H3C.2 Homozygous. Outer Left Sequence: tttcgtcgctgtagttcgtg. Outer Right Sequence: gggaattcctggccatttac. Inner Left Sequence: gctggcaagcgtcagatac. Inner Right Sequence: cagtggcgagcgttaacata. Inner Primer PCR Length: 1122. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2198 |
C. elegans |
C27B7.7(ok2978) IV. Show Description
C27B7.7 Homozygous. Outer Left Sequence: catgacgtcggttacactgg. Outer Right Sequence: ctccgggtcctgaaacatta. Inner Left Sequence: gccaaatctgtttgaagaactg. Inner Right Sequence: gcatggattcgtgtcttcct. Inner Primer PCR Length: 1143. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2199 |
C. elegans |
K06A4.3(ok2979) V. Show Description
K06A4.3 Homozygous. Outer Left Sequence: gccaccagagagtggaagac. Outer Right Sequence: gaaatacgatggttgtgggg. Inner Left Sequence: gaatcaagggaatggctcgt. Inner Right Sequence: gttctgcacggatcgaactt. Inner Primer PCR Length: 1119. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2200 |
C. elegans |
gst-24(ok2980) II. Show Description
F37B1.1 Homozygous. Outer Left Sequence: gcgacgattcatggtctttt. Outer Right Sequence: ctctccctcccctcaatttc. Inner Left Sequence: caaactccccaggtgtgact. Inner Right Sequence: ggagattttcgaaacgactttg. Inner Primer PCR Length: 1156. Deletion size: about 600 bp. ttggtcagctcccattcctc [ 603 bp deletion] caagttatctaggcacgagg -- Wild type ttggtcagctcccattcctc ------------------ caagttatctaggcacgagg -- ok2980 Sequence shown is on the minus strand. Deletion starts in the second exon and removes the downstream part of that exon, the 3'-UTR, and approximately 0.1 kb of downstream flanking sequence. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2201 |
C. elegans |
M60.6(ok2981) X. Show Description
M60.6 Homozygous. Outer Left Sequence: cacgtacgaaaccccaaagt. Outer Right Sequence: agttgcacaatccttttcgc. Inner Left Sequence: ttctcctgagaaagaatttggttt. Inner Right Sequence: gttatcggaaacaacgacgg. Inner Primer PCR Length: 1302. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2202 |
C. elegans |
vit-4(ok2982) X. Show Description
F59D8.2 Homozygous. Outer Left Sequence: cagcgtgagcattttgagaa. Outer Right Sequence: caaagctgaggtcaacccat. Inner Left Sequence: cgaagacggtttcgaatgat. Inner Right Sequence: tcaaggctatcgagatagagca. Inner Primer PCR Length: 1165. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2203 |
C. elegans |
F01G12.6(ok2983) X. Show Description
F01G12.6 Homozygous. Outer Left Sequence: ttgggacgagaaaatgaagg. Outer Right Sequence: ccaagttgagggtctcggta. Inner Left Sequence: ttgtgcatgggagaagttga. Inner Right Sequence: tgcaacattcataaaaatgcaa. Inner Primer PCR Length: 1279. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2204 |
C. elegans |
W10G6.1(ok2984) X. Show Description
W10G6.1 Homozygous. Outer Left Sequence: tgcatgcaactggaaacatt. Outer Right Sequence: ttatcacgtcggaagaggct. Inner Left Sequence: tgtgaatcagcagaaatgtcaa. Inner Right Sequence: accttcaactgcaggacgat. Inner Primer PCR Length: 1190. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2205 |
C. elegans |
hex-2(ok2985) V. Show Description
C14C11.3 Homozygous. Outer Left Sequence: acactcggttttcggctatg. Outer Right Sequence: tttcccaccaagcacctaac. Inner Left Sequence: atttccagaatccttgcgtg. Inner Right Sequence: agcgcatttttctgcatctc. Inner Primer PCR Length: 1120. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|