Search Strains

More Fields
Strain Species Genotype Add
RB2155 C. elegans Y71D11A.5(ok2900) III. Show Description
Y71D11A.5 Homozygous. Outer Left Sequence: ccagtttcagctgtgtcgaa. Outer Right Sequence: gttttgcacgtacttccacg. Inner Left Sequence: aaactaggcttgttgggggt. Inner Right Sequence: cgaagctaataatggtgccaa. Inner Primer PCR Length: 1313. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2156 C. elegans R02F11.1(ok2901) V. Show Description
R02F11.1 Homozygous. Outer Left Sequence: atgaagcaactcgccatctc. Outer Right Sequence: agaaagactgggggcaattt. Inner Left Sequence: atccgactttcagctccaga. Inner Right Sequence: aggtgtatccagttgggcag. Inner Primer PCR Length: 1108. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2157 C. elegans cdh-12(ok2902) III. Show Description
Y71D11A.1 Homozygous. Outer Left Sequence: atggccgagtacaccttcac. Outer Right Sequence: ccagagtcctgagcttccac. Inner Left Sequence: attccgcaaaactccacg. Inner Right Sequence: aggatcgtaacgttcaaccg. Inner Primer PCR Length: 1102. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2158 C. elegans Y41E3.3(ok2918) IV. Show Description
Y41E3.3 Homozygous. Outer Left Sequence: ctcggcacatatttcggttt. Outer Right Sequence: atatgcccagtcaactccca. Inner Left Sequence: gaaattttcccgaactttcaa. Inner Right Sequence: aaaaagtttcccaaaaaccg. Inner Primer PCR Length: 1098. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2159 C. elegans ins-16(ok2919) III. Show Description
Y39A3A.5 Homozygous. Outer Left Sequence: gagcgcgtaaatcttagcca. Outer Right Sequence: ttaattccggcaaagtaccg. Inner Left Sequence: gtctgaaccttggtcaagca. Inner Right Sequence: ggaaaatttcaatttcggca. Inner Primer PCR Length: 1191. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2160 C. elegans cdh-10(ok2920) IV. Show Description
C45G7.5 Homozygous. Outer Left Sequence: acctcaaatccccgatcttt. Outer Right Sequence: taggccaccaacttcaatcc. Inner Left Sequence: tcaaaaaccgtggtgatcatt. Inner Right Sequence: cccactctgcagttttcaca. Inner Primer PCR Length: 1163. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2161 C. elegans ZK858.6(ok2921) I. Show Description
ZK858.6 Homozygous. Outer Left Sequence: agttcgatgaacatggctcc. Outer Right Sequence: cgacaatttgccagttgcta. Inner Left Sequence: ctccagcgatgagtgaactg. Inner Right Sequence: ctgttatcaatccagcgcaa. Inner Primer PCR Length: 1327. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2162 C. elegans C18H9.8(ok2922) II. Show Description
C18H9.8 Homozygous. Outer Left Sequence: gatgcctgtgtcaagagctg. Outer Right Sequence: ccacttcaaccttgccaact. Inner Left Sequence: ggacctccaagagcacctact. Inner Right Sequence: acgcacaattccatgaagaa. Inner Primer PCR Length: 1309. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2163 C. elegans hmit-1.1(ok2923) V. Show Description
Y51A2D.4 Homozygous. Outer Left Sequence: aaggccgttttagtccgaat. Outer Right Sequence: tatttgtgcatgagcccgta. Inner Left Sequence: tttggatttccaggttctcg. Inner Right Sequence: atcaaagcctgctggaagac. Inner Primer PCR Length: 1151. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2164 C. elegans T04D3.3(ok2924) I. Show Description
T04D3.3 Homozygous. Outer Left Sequence: tctcacagttcacctgacgc. Outer Right Sequence: cggaagttttggctagcagt. Inner Left Sequence: ttcaaggataaatttgccgc. Inner Right Sequence: agggtcactgcatttttcca. Inner Primer PCR Length: 1290. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2165 C. elegans C06E7.1(ok2932) IV. Show Description
C06E7.1 Homozygous. Outer Left Sequence: gttctcgtccgaaacgtcat. Outer Right Sequence: gaaattggggaggaatttgg. Inner Left Sequence: tgcaatgttcttgttgcactc. Inner Right Sequence: ggatatcgaggatattgcgg. Inner Primer PCR Length: 1179. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2166 C. elegans his-70(ok2933) III. Show Description
E03A3.4 Homozygous. Outer Left Sequence: tccgtaaactttaggccacg. Outer Right Sequence: tgttcattgaaatcaccgga. Inner Left Sequence: ccatccactgcagacacagt. Inner Right Sequence: acgtttttgaacgaaatggg. Inner Primer PCR Length: 1316. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2167 C. elegans secs-1(ok2934) V. Show Description
D1054.13 Homozygous. Outer Left Sequence: accttgccagcgtcataatc. Outer Right Sequence: cacgcagtgaaatcttgcat. Inner Left Sequence: aaatgattcgttgatcggga. Inner Right Sequence: tgttgtacccctttgcactg. Inner Primer PCR Length: 1121. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2168 C. elegans ZK1240.2(ok2935) II. Show Description
ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2169 C. elegans F29G6.3(ok2936) X. Show Description
F29G6.3 Homozygous. Outer Left Sequence: tgtggtgctcatgcttcttc. Outer Right Sequence: tcacacacctacaggtccca. Inner Left Sequence: ctcaaactttctgcgaaggg. Inner Right Sequence: tccgctttgactcatgacag. Inner Primer PCR Length: 1207. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2170 C. elegans clc-11(ok2937) V. Show Description
F44G3.10. Homozygous. Outer Left Sequence: TAGCACACAAGGTGGCACTC. Outer Right Sequence: AAAACTCCCAACTCTTCGCA. Inner Left Sequence: CTCACATCCCAGGAAGCATT. Inner Right Sequence: AACGTTTTTGCTGACACACG. Inner Primer PCR Length: 1145 bp. Deletion Size: 664 bp. Deletion left flank: AGTAATAATAAGAATTTAATAAACGAGTAA. Deletion right flank: AACGATTCCAACGCTGCCTCCATCATCCGT. Insertion Sequence: AACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2171 C. elegans Y4C6A.1(ok2938) IV. Show Description
Y4C6A.1. Homozygous. Outer Left Sequence: GAAAACTCCAAACGGGACAA. Outer Right Sequence: ATTCGGCATACCTTCAAACG. Inner Left Sequence: AAATCAAAAGCCGTTCGTG. Inner Right Sequence: CCCCAACTGAAAATGGCTTA. Inner Primer PCR Length: 1236 bp. Deletion Size: 408 bp. Deletion left flank: CTGTTCAAGTGCAACTTTTCAACTTCTGAA. Deletion right flank: CTGTATTCATCGGTTCGTTTTCTTAAAAAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2172 C. elegans ttr-30(ok2939) X. Show Description
T08A9.2. Homozygous. Outer Left Sequence: TAGCGGTGACTCAACGGATT. Outer Right Sequence: AGAAACACGAGTCCCGAGAA. Inner Left Sequence: AAAACGAAGTCACATCATTGAAAA. Inner Right Sequence: CGTGGTTTTTGATAGGAGTACCA. Inner Primer PCR Length: 1116 bp. Deletion Size: 501 bp. Deletion left flank: GAAACATTTGCTATAAAACTTCTCGTCCTC. Deletion right flank: AATCTTCAATCGGTTTCTGTGAACGGAACA. Insertion Sequence: AGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2173 C. elegans F12D9.1(ok2940) X. Show Description
F12D9.1. Homozygous. Outer Left Sequence: TAATGTGGTCCGCACAAAAA. Outer Right Sequence: GAGCAAAGTTGCGATTGTGA. Inner Left Sequence: TTTACTTGTGCATTTTTCCCA. Inner Right Sequence: TAGCGCAGCGTAGTTGGATA. Inner Primer PCR Length: 1192 bp. Deletion Size: 543 bp. Deletion left flank: ACGCGGCCACATTCTTCCCAGTCACGTTTT. Deletion right flank: TTTCAGATGCTGTAATTAGGATTTAGTTGA. Insertion Sequence: TTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2174 C. elegans F59D6.7(ok2941) V. Show Description
F59D6.7. Homozygous. Outer Left Sequence: ACGGGCAAATTCCACATATT. Outer Right Sequence: AATACAAAACGGTATGCGCC. Inner Left Sequence: TTCATACATTTGATTGGTGTACTAA. Inner Right Sequence: AAATGCACACGTGGGGTTAG. Inner Primer PCR Length: 1297 bp. Deletion Size: 570 bp. Deletion left flank: TAGAAATTAATTCAAAAATCGCATCGACAT. Deletion right flank: CTGGGACATTCAAGAAGTCGTCACGTGACA. Insertion Sequence: CATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2175 C. elegans klp-20(ok2942) III. Show Description
Y50D7A.6. Homozygous. Outer Left Sequence: ATCACAACGGGAATCTGGAG. Outer Right Sequence: TTCAACGGCAAAAATGTTCA. Inner Left Sequence: GAATTTGGAATCCTCCCGAT. Inner Right Sequence: TCATATTTCTCACCTCAATTTCTCA. Inner Primer PCR Length: 1133 bp. Deletion Size: 588 bp. Deletion left flank: CAAGGAGAGCGGTTGAAGGAGGCGGCGAAG. Deletion right flank: CAAATCGTGCGAAGAATATTCAAAACGTCG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2176 C. elegans gly-4(ok2943) V. Show Description
Y116F11B.12. Homozygous. Outer Left Sequence: TGACACCAGATTTGACGGAA. Outer Right Sequence: CAAAAACCTCCGAAGCACAT. Inner Left Sequence: AAATTTTGCTTTTTGGGCCT. Inner Right Sequence: CCAAATTTTGCGACTTACTATCG. Inner Primer PCR Length: 1177 bp. Deletion Size: 617 bp. Deletion left flank: ATCATCACGGCACAATGAGAAAAGTTGCTC. Deletion right flank: ATTAGATGTCGATAGTAAGTCGCAAAATTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2177 C. elegans hlh-11(ok2944) III. Show Description
F58A4.7. Homozygous. Outer Left Sequence: AAGCTTGCGTCTTGAGAAGG. Outer Right Sequence: AAACTTGGCAATGTTGGAGG. Inner Left Sequence: GAGGAGATGATGAGTTCGGG. Inner Right Sequence: GGAATATACGTTGAGACGCCA. Inner Primer PCR Length: 1099 bp. Deletion Size: 432 bp. Deletion left flank: GGACACAAAGGAGAAGATATACCTGACGGT. Deletion right flank: CACATTGCCATCTTCATATGCTTCATCGGC. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2178 C. elegans sre-48(ok2945) II. Show Description
Y39G8B.3. Homozygous. Outer Left Sequence: AGGTGCACACCTTTTTGCAT. Outer Right Sequence: ACCTTTTGGAAAAATTGCGA. Inner Left Sequence: AGCGACTGGGTGAAACAGAA. Inner Right Sequence: GCACCTGAATAATGCGAAAAA. Inner Primer PCR Length: 1272 bp. Deletion Size: 508 bp. Deletion left flank: GTCTCTGTCTCCTTTTTCAGCTCTTCGCAC. Deletion right flank: AGAATTTTCTAGAATTTTCCAAAAGGTTTC. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2179 C. elegans F59A3.10(ok2955) I. Show Description
F59A3.10 Homozygous. Outer Left Sequence: ttgccgaaaataagtttgcc. Outer Right Sequence: ttagtgtcgtcagtggggaa. Inner Left Sequence: acggctatttcctctgaacg. Inner Right Sequence: tcaaaatgggtcaaaaagaaaaa. Inner Primer PCR Length: 1236. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2180 C. elegans W07B8.1(ok2956) V. Show Description
W07B8.1. Homozygous. Outer Left Sequence: TGTGGGAATTTGCCAAAACT. Outer Right Sequence: GTCGACCTGTTGCGACCTAT. Inner Left Sequence: GGCCGGAAATTATTAGGTCA. Inner Right Sequence: ACTTTCAGCCACTTTCGTCG. Inner Primer PCR Length: 1352 bp. Deletion Size: 561 bp. Deletion left flank: CACGGTATTCCTACCGGAGGATCCTATGAA. Deletion right flank: AACTTCCAGTTATTGCAAAAGAAAAACGGA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2181 C. elegans ZK643.3(ok2957) III. Show Description
ZK643.3. Homozygous. Outer Left Sequence: AACTCGCAAAGCTCCAAAAA. Outer Right Sequence: TCGCTTCAAGACCCAGTACC. Inner Left Sequence: CTATTCTAACGGCTCGCCAA. Inner Right Sequence: CCGATCCATTTCAATTTGCT. Inner Primer PCR Length: 1177 bp. Deletion Size: 534 bp. Deletion left flank: CTCATCTCATGTCTCTTATACGGAGCATTC. Deletion right flank: ATAGAATTCCAAGCATTGGATAATGATTAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2182 C. elegans ZK632.3(ok2958) III. Show Description
ZK632.3. Homozygous. Outer Left Sequence: CGCTCATCGTCAGTGAAAAA. Outer Right Sequence: GTCAGTTTTGCGGATGTCCT. Inner Left Sequence: CCCATTCCACGTTTTTGAGT. Inner Right Sequence: ACTTGCTCTTCAACGCCATT. Inner Primer PCR Length: 1108 bp. Deletion Size: 371 bp. Deletion left flank: GCCGACCATATCGCCTGTTGGAAGGGTGTT. Deletion right flank: AAGACGAGAATTCGTTGCATTTTCCTCATC. Insertion Sequence: TCCCTTCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2183 C. elegans grl-16(ok2959) I. Show Description
Y65B4BR.6. Homozygous. Outer Left Sequence: AACTGAAGTGTGGGTGAGGG. Outer Right Sequence: TCATTCGGAAATGAACACGA. Inner Left Sequence: GGAGTGGTGCGAATCTGACT. Inner Right Sequence: CTTCCCCCTATTCTGCAACA. Inner Primer PCR Length: 1236 bp. Deletion Size: 473 bp. Deletion left flank: TCCGGCGTTGTAGCCTCCTTGTGGGGCGAC. Deletion right flank: AAGTAGAATGGACTTTGTCGCTCCTTAAGG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2184 C. elegans clc-32(ok2960) V. Show Description
F10A3.1. Homozygous. Outer Left Sequence: TGCGGACTGCAAATAAAGTG. Outer Right Sequence: CGTGTGCTTTGTACGCTGAT. Inner Left Sequence: TCCCGTTTCTACTTGGTTTTT. Inner Right Sequence: TTCCGAAACAAAATGCACAA. Inner Primer PCR Length: 1208 bp. Deletion Size: 327 bp. Deletion left flank: TTCAGGGTAAGCACTAAATTGAGTTCCGTG. Deletion right flank: GTGTGTAAGCAAGTGCGTTATGAAATTGTG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2185 C. elegans glt-4(ok2961) X. Show Description
T22E5.2. Homozygous. Outer Left Sequence: GCCTCATTGGATTCTGGAAC. Outer Right Sequence: TTTTATCGGATTACGGCGAG. Inner Left Sequence: GCAGGAAGATTAGGAATGGTG. Inner Right Sequence: GCCAAAAAGCTCAAAATTGG. Inner Primer PCR Length: 1130 bp. Deletion Size: 343 bp. Deletion left flank: ATCGGATGGGTCATTATGTAATATTGAAAT. Deletion right flank: TTAATCTTGACTCGAATCGAGAATGATAGG. Insertion Sequence: TTAATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2186 C. elegans H25K10.5(ok2962) IV. Show Description
H25K10.5. Homozygous. Outer Left Sequence: TGGGCCCTAACGCATACTAC. Outer Right Sequence: CCGGTTGTACAGCCCTACTC. Inner Left Sequence: CGGTTATCTAGGTGTGGCCT. Inner Right Sequence: AGGCGAAACTCACTACATCCA. Inner Primer PCR Length: 1227 bp. Deletion Size: 570 bp. Deletion left flank: TGATAAAACTCACTTCCACACTTTCGAGCC. Deletion right flank: TGTCACATAGAAAACGAAAGTATAATCCTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2187 C. elegans lgc-47(ok2963) X. Show Description
F47A4.1. Homozygous. Outer Left Sequence: GCCCGAAGAAGATTACCAAA. Outer Right Sequence: ACGACCCAACGAACAGAAAC. Inner Left Sequence: TCCTTTCATTCTTTTGCTCACA. Inner Right Sequence: AAGCGGAAAGTGTTTCTCCTC. Inner Primer PCR Length: 1179 bp. Deletion Size: 521 bp. Deletion left flank: GTCATATAGGTTGGAATGTAACCTTGCAAG. Deletion right flank: TACTAAAGTTTGTCATTGTGAAATCAGGTA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2188 C. elegans flp-20(ok2964) X. Show Description
E01H11.3 Homozygous. Outer Left Sequence: ccgattgccaaaacgattac. Outer Right Sequence: agcccgcttccttcatagtt. Inner Left Sequence: tcatgaagctatcggaagatca. Inner Right Sequence: tcctccatcaccagacaaca. Inner Primer PCR Length: 1194. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2189 C. elegans Y41E3.3(ok2969) IV. Show Description
Y41E3.3 Homozygous. Outer Left Sequence: ctcggcacatatttcggttt. Outer Right Sequence: atatgcccagtcaactccca. Inner Left Sequence: gaaattttcccgaactttcaa. Inner Right Sequence: aaaaagtttcccaaaaaccg. Inner Primer PCR Length: 1098. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2191 C. elegans C35D10.11(ok2971) III. Show Description
C35D10.11 Homozygous. Outer Left Sequence: ttacatgggtgcaaatgtcg. Outer Right Sequence: ataccccaacataatgccca. Inner Left Sequence: ttcagcttctccgccactac. Inner Right Sequence: caactgaacacgtcattgtgg. Inner Primer PCR Length: 1257. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2192 C. elegans grd-10(ok2972) IV. Show Description
F09D12.1 Homozygous. Outer Left Sequence: tcgtcatctttttgtcgctg. Outer Right Sequence: attgaaccaatagttgcggg. Inner Left Sequence: ttcttgtgttccaaaagggc. Inner Right Sequence: ttgagatagggtaaaagaagatcg. Inner Primer PCR Length: 1202. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2193 C. elegans F44G3.2(ok2973) V. Show Description
F44G3.2 Homozygous. Outer Left Sequence: tgcacagattggtcttcgac. Outer Right Sequence: aggtccaaatgatgtcagcc. Inner Left Sequence: tttcaactctgtgtcttggca. Inner Right Sequence: ccgcattattcgttaagggt. Inner Primer PCR Length: 1144. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2194 C. elegans math-33(ok2974) V. Show Description
H19N07.2 Homozygous. Outer Left Sequence: gaaagttcgcggactgaatc. Outer Right Sequence: cttgtcggtcattgtgtcgt. Inner Left Sequence: cgtgcattcgaagcttacac. Inner Right Sequence: cgaaaaatagaaggtcccct. Inner Primer PCR Length: 1180. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2195 C. elegans C16E9.2(ok2975) X. Show Description
C16E9.2 Homozygous. Outer Left Sequence: tgttgctgaagcaattcgac. Outer Right Sequence: ccccctttgaaaacaagaca. Inner Left Sequence: gttggcaacacagcaaggta. Inner Right Sequence: cagctcgttctcctcgtttc. Inner Primer PCR Length: 1373. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2196 C. elegans K08D10.14(ok2976) IV. Show Description
K08D10.14 Homozygous. Outer Left Sequence: aatttagcgtacgccactcg. Outer Right Sequence: aggagaatgtggtaaggcga. Inner Left Sequence: agcacgcgctttgtgttt. Inner Right Sequence: agaccaaattctgtgggtgtg. Inner Primer PCR Length: 1275. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2197 C. elegans srw-99(ok2977) V. Show Description
Y46H3C.2 Homozygous. Outer Left Sequence: tttcgtcgctgtagttcgtg. Outer Right Sequence: gggaattcctggccatttac. Inner Left Sequence: gctggcaagcgtcagatac. Inner Right Sequence: cagtggcgagcgttaacata. Inner Primer PCR Length: 1122. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2198 C. elegans C27B7.7(ok2978) IV. Show Description
C27B7.7 Homozygous. Outer Left Sequence: catgacgtcggttacactgg. Outer Right Sequence: ctccgggtcctgaaacatta. Inner Left Sequence: gccaaatctgtttgaagaactg. Inner Right Sequence: gcatggattcgtgtcttcct. Inner Primer PCR Length: 1143. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2199 C. elegans K06A4.3(ok2979) V. Show Description
K06A4.3 Homozygous. Outer Left Sequence: gccaccagagagtggaagac. Outer Right Sequence: gaaatacgatggttgtgggg. Inner Left Sequence: gaatcaagggaatggctcgt. Inner Right Sequence: gttctgcacggatcgaactt. Inner Primer PCR Length: 1119. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2200 C. elegans gst-24(ok2980) II. Show Description
F37B1.1 Homozygous. Outer Left Sequence: gcgacgattcatggtctttt. Outer Right Sequence: ctctccctcccctcaatttc. Inner Left Sequence: caaactccccaggtgtgact. Inner Right Sequence: ggagattttcgaaacgactttg. Inner Primer PCR Length: 1156. Deletion size: about 600 bp. ttggtcagctcccattcctc [ 603 bp deletion] caagttatctaggcacgagg -- Wild type ttggtcagctcccattcctc ------------------ caagttatctaggcacgagg -- ok2980 Sequence shown is on the minus strand. Deletion starts in the second exon and removes the downstream part of that exon, the 3'-UTR, and approximately 0.1 kb of downstream flanking sequence. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2201 C. elegans M60.6(ok2981) X. Show Description
M60.6 Homozygous. Outer Left Sequence: cacgtacgaaaccccaaagt. Outer Right Sequence: agttgcacaatccttttcgc. Inner Left Sequence: ttctcctgagaaagaatttggttt. Inner Right Sequence: gttatcggaaacaacgacgg. Inner Primer PCR Length: 1302. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2202 C. elegans vit-4(ok2982) X. Show Description
F59D8.2 Homozygous. Outer Left Sequence: cagcgtgagcattttgagaa. Outer Right Sequence: caaagctgaggtcaacccat. Inner Left Sequence: cgaagacggtttcgaatgat. Inner Right Sequence: tcaaggctatcgagatagagca. Inner Primer PCR Length: 1165. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2203 C. elegans F01G12.6(ok2983) X. Show Description
F01G12.6 Homozygous. Outer Left Sequence: ttgggacgagaaaatgaagg. Outer Right Sequence: ccaagttgagggtctcggta. Inner Left Sequence: ttgtgcatgggagaagttga. Inner Right Sequence: tgcaacattcataaaaatgcaa. Inner Primer PCR Length: 1279. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2204 C. elegans W10G6.1(ok2984) X. Show Description
W10G6.1 Homozygous. Outer Left Sequence: tgcatgcaactggaaacatt. Outer Right Sequence: ttatcacgtcggaagaggct. Inner Left Sequence: tgtgaatcagcagaaatgtcaa. Inner Right Sequence: accttcaactgcaggacgat. Inner Primer PCR Length: 1190. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2205 C. elegans hex-2(ok2985) V. Show Description
C14C11.3 Homozygous. Outer Left Sequence: acactcggttttcggctatg. Outer Right Sequence: tttcccaccaagcacctaac. Inner Left Sequence: atttccagaatccttgcgtg. Inner Right Sequence: agcgcatttttctgcatctc. Inner Primer PCR Length: 1120. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807