Search Strains

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and Uncs which arrest in early larval development. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and larval lethal Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and larval lethal Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and Sterile Unc-4's. spe-3 homozygotes lay self-fertilized eggs that do not hatch. Oocytes can be rescued by fertilization with mutant sperm from spe-3/+ males. Maintain by picking WT.

Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs and paralyzed DpyUnc. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs and paralysed DpyUncs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, DpyUnc and kinker Uncs which arrest as early larvae. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs and paralyzed DpyUnc. Maintain by picking WT.

Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs and paralysed DpyUnc. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs and DpyUnc. Maintain by picking WT. [2/97: This strain also throws Dpys. RK Herman put a new mnC1 dpy-10 unc-52 chromosome into the strains, and it still continues to throw Dpys. It seems that the mnC1 dpy-10 unc-52 chromosome is correct. It's possible that the mnDf97 chromosome is broken.]

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are Dpy and segregate Dpy, dead eggs and paralysed DpyUnc. Maintain by picking Dpy.

Hets are WT and segregate WT, paralysed DpyUnc and Unc-4 lethals that arrest at L2. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT. [12/93 **mnC1 appears to have broken down**]

Heterozygotes are WT and segregate WT, DpyUnc and Uncs which give sterile progeny (maternal effect sterile: the progeny from mutant mothers are sterile). The mutation is a strict mel, fully penetrant, and fully expressed. Sterility is due to a failure in germ-cell proliferation.

Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2.

Crispr/Cas9-engineered indel in the 5’ region of rpa-1. Larval-lethal mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP iow117 homozygotes (larval lethal). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. iow117 was generated in mre-11::GFP background and outcrossed to N2. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.

Heterozygotes are WT and segregate WT, Dpy Uncs, and animals with muscle attachment defects and ventral cord displacement and detachment. Not well balanced. klf-3 was formerly known as mua-1.