Search Strains

Y71D11A.1 Homozygous. Outer Left Sequence: atggccgagtacaccttcac. Outer Right Sequence: ccagagtcctgagcttccac. Inner Left Sequence: attccgcaaaactccacg. Inner Right Sequence: aggatcgtaacgttcaaccg. Inner Primer PCR Length: 1102. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41E3.3 Homozygous. Outer Left Sequence: ctcggcacatatttcggttt. Outer Right Sequence: atatgcccagtcaactccca. Inner Left Sequence: gaaattttcccgaactttcaa. Inner Right Sequence: aaaaagtttcccaaaaaccg. Inner Primer PCR Length: 1098. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39A3A.5 Homozygous. Outer Left Sequence: gagcgcgtaaatcttagcca. Outer Right Sequence: ttaattccggcaaagtaccg. Inner Left Sequence: gtctgaaccttggtcaagca. Inner Right Sequence: ggaaaatttcaatttcggca. Inner Primer PCR Length: 1191. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C45G7.5 Homozygous. Outer Left Sequence: acctcaaatccccgatcttt. Outer Right Sequence: taggccaccaacttcaatcc. Inner Left Sequence: tcaaaaaccgtggtgatcatt. Inner Right Sequence: cccactctgcagttttcaca. Inner Primer PCR Length: 1163. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK858.6 Homozygous. Outer Left Sequence: agttcgatgaacatggctcc. Outer Right Sequence: cgacaatttgccagttgcta. Inner Left Sequence: ctccagcgatgagtgaactg. Inner Right Sequence: ctgttatcaatccagcgcaa. Inner Primer PCR Length: 1327. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18H9.8 Homozygous. Outer Left Sequence: gatgcctgtgtcaagagctg. Outer Right Sequence: ccacttcaaccttgccaact. Inner Left Sequence: ggacctccaagagcacctact. Inner Right Sequence: acgcacaattccatgaagaa. Inner Primer PCR Length: 1309. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51A2D.4 Homozygous. Outer Left Sequence: aaggccgttttagtccgaat. Outer Right Sequence: tatttgtgcatgagcccgta. Inner Left Sequence: tttggatttccaggttctcg. Inner Right Sequence: atcaaagcctgctggaagac. Inner Primer PCR Length: 1151. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T04D3.3 Homozygous. Outer Left Sequence: tctcacagttcacctgacgc. Outer Right Sequence: cggaagttttggctagcagt. Inner Left Sequence: ttcaaggataaatttgccgc. Inner Right Sequence: agggtcactgcatttttcca. Inner Primer PCR Length: 1290. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06E7.1 Homozygous. Outer Left Sequence: gttctcgtccgaaacgtcat. Outer Right Sequence: gaaattggggaggaatttgg. Inner Left Sequence: tgcaatgttcttgttgcactc. Inner Right Sequence: ggatatcgaggatattgcgg. Inner Primer PCR Length: 1179. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E03A3.4 Homozygous. Outer Left Sequence: tccgtaaactttaggccacg. Outer Right Sequence: tgttcattgaaatcaccgga. Inner Left Sequence: ccatccactgcagacacagt. Inner Right Sequence: acgtttttgaacgaaatggg. Inner Primer PCR Length: 1316. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D1054.13 Homozygous. Outer Left Sequence: accttgccagcgtcataatc. Outer Right Sequence: cacgcagtgaaatcttgcat. Inner Left Sequence: aaatgattcgttgatcggga. Inner Right Sequence: tgttgtacccctttgcactg. Inner Primer PCR Length: 1121. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F29G6.3 Homozygous. Outer Left Sequence: tgtggtgctcatgcttcttc. Outer Right Sequence: tcacacacctacaggtccca. Inner Left Sequence: ctcaaactttctgcgaaggg. Inner Right Sequence: tccgctttgactcatgacag. Inner Primer PCR Length: 1207. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59A3.10 Homozygous. Outer Left Sequence: ttgccgaaaataagtttgcc. Outer Right Sequence: ttagtgtcgtcagtggggaa. Inner Left Sequence: acggctatttcctctgaacg. Inner Right Sequence: tcaaaatgggtcaaaaagaaaaa. Inner Primer PCR Length: 1236. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E01H11.3 Homozygous. Outer Left Sequence: ccgattgccaaaacgattac. Outer Right Sequence: agcccgcttccttcatagtt. Inner Left Sequence: tcatgaagctatcggaagatca. Inner Right Sequence: tcctccatcaccagacaaca. Inner Primer PCR Length: 1194. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41E3.3 Homozygous. Outer Left Sequence: ctcggcacatatttcggttt. Outer Right Sequence: atatgcccagtcaactccca. Inner Left Sequence: gaaattttcccgaactttcaa. Inner Right Sequence: aaaaagtttcccaaaaaccg. Inner Primer PCR Length: 1098. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C35D10.11 Homozygous. Outer Left Sequence: ttacatgggtgcaaatgtcg. Outer Right Sequence: ataccccaacataatgccca. Inner Left Sequence: ttcagcttctccgccactac. Inner Right Sequence: caactgaacacgtcattgtgg. Inner Primer PCR Length: 1257. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09D12.1 Homozygous. Outer Left Sequence: tcgtcatctttttgtcgctg. Outer Right Sequence: attgaaccaatagttgcggg. Inner Left Sequence: ttcttgtgttccaaaagggc. Inner Right Sequence: ttgagatagggtaaaagaagatcg. Inner Primer PCR Length: 1202. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44G3.2 Homozygous. Outer Left Sequence: tgcacagattggtcttcgac. Outer Right Sequence: aggtccaaatgatgtcagcc. Inner Left Sequence: tttcaactctgtgtcttggca. Inner Right Sequence: ccgcattattcgttaagggt. Inner Primer PCR Length: 1144. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H19N07.2 Homozygous. Outer Left Sequence: gaaagttcgcggactgaatc. Outer Right Sequence: cttgtcggtcattgtgtcgt. Inner Left Sequence: cgtgcattcgaagcttacac. Inner Right Sequence: cgaaaaatagaaggtcccct. Inner Primer PCR Length: 1180. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16E9.2 Homozygous. Outer Left Sequence: tgttgctgaagcaattcgac. Outer Right Sequence: ccccctttgaaaacaagaca. Inner Left Sequence: gttggcaacacagcaaggta. Inner Right Sequence: cagctcgttctcctcgtttc. Inner Primer PCR Length: 1373. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08D10.14 Homozygous. Outer Left Sequence: aatttagcgtacgccactcg. Outer Right Sequence: aggagaatgtggtaaggcga. Inner Left Sequence: agcacgcgctttgtgttt. Inner Right Sequence: agaccaaattctgtgggtgtg. Inner Primer PCR Length: 1275. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.2 Homozygous. Outer Left Sequence: tttcgtcgctgtagttcgtg. Outer Right Sequence: gggaattcctggccatttac. Inner Left Sequence: gctggcaagcgtcagatac. Inner Right Sequence: cagtggcgagcgttaacata. Inner Primer PCR Length: 1122. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27B7.7 Homozygous. Outer Left Sequence: catgacgtcggttacactgg. Outer Right Sequence: ctccgggtcctgaaacatta. Inner Left Sequence: gccaaatctgtttgaagaactg. Inner Right Sequence: gcatggattcgtgtcttcct. Inner Primer PCR Length: 1143. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06A4.3 Homozygous. Outer Left Sequence: gccaccagagagtggaagac. Outer Right Sequence: gaaatacgatggttgtgggg. Inner Left Sequence: gaatcaagggaatggctcgt. Inner Right Sequence: gttctgcacggatcgaactt. Inner Primer PCR Length: 1119. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37B1.1 Homozygous. Outer Left Sequence: gcgacgattcatggtctttt. Outer Right Sequence: ctctccctcccctcaatttc. Inner Left Sequence: caaactccccaggtgtgact. Inner Right Sequence: ggagattttcgaaacgactttg. Inner Primer PCR Length: 1156. Deletion size: about 600 bp. ttggtcagctcccattcctc [ 603 bp deletion] caagttatctaggcacgagg -- Wild type ttggtcagctcccattcctc ------------------ caagttatctaggcacgagg -- ok2980 Sequence shown is on the minus strand. Deletion starts in the second exon and removes the downstream part of that exon, the 3'-UTR, and approximately 0.1 kb of downstream flanking sequence. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M60.6 Homozygous. Outer Left Sequence: cacgtacgaaaccccaaagt. Outer Right Sequence: agttgcacaatccttttcgc. Inner Left Sequence: ttctcctgagaaagaatttggttt. Inner Right Sequence: gttatcggaaacaacgacgg. Inner Primer PCR Length: 1302. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59D8.2 Homozygous. Outer Left Sequence: cagcgtgagcattttgagaa. Outer Right Sequence: caaagctgaggtcaacccat. Inner Left Sequence: cgaagacggtttcgaatgat. Inner Right Sequence: tcaaggctatcgagatagagca. Inner Primer PCR Length: 1165. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G12.6 Homozygous. Outer Left Sequence: ttgggacgagaaaatgaagg. Outer Right Sequence: ccaagttgagggtctcggta. Inner Left Sequence: ttgtgcatgggagaagttga. Inner Right Sequence: tgcaacattcataaaaatgcaa. Inner Primer PCR Length: 1279. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W10G6.1 Homozygous. Outer Left Sequence: tgcatgcaactggaaacatt. Outer Right Sequence: ttatcacgtcggaagaggct. Inner Left Sequence: tgtgaatcagcagaaatgtcaa. Inner Right Sequence: accttcaactgcaggacgat. Inner Primer PCR Length: 1190. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14C11.3 Homozygous. Outer Left Sequence: acactcggttttcggctatg. Outer Right Sequence: tttcccaccaagcacctaac. Inner Left Sequence: atttccagaatccttgcgtg. Inner Right Sequence: agcgcatttttctgcatctc. Inner Primer PCR Length: 1120. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T25D3.3 Homozygous. Outer Left Sequence: caaaattggagccaaaggaa. Outer Right Sequence: tctcgaacgtcttcgtgatg. Inner Left Sequence: gacccgagagcgtgatttta. Inner Right Sequence: ttggtgacaaaatgttcgga. Inner Primer PCR Length: 1186. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08F8.1 Homozygous. Outer Left Sequence: cagaatcacgccatgagcta. Outer Right Sequence: tcgtgtgggaacgcataata. Inner Left Sequence: tggtgattgggggttaagaa. Inner Right Sequence: agcgacacctttcatcgagt. Inner Primer PCR Length: 1298. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H22K11.2 Homozygous. Outer Left Sequence: cttggtggctcatcaggaat. Outer Right Sequence: gtaaagggcaccctgaacaa. Inner Left Sequence: ggaaagtaccggagcagtga. Inner Right Sequence: ttggcacgtttttaattttgg. Inner Primer PCR Length: 1266. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04G2.8 Homozygous. Outer Left Sequence: tgtcctgggtaggttgggta. Outer Right Sequence: atcccgaatctgtccaatca. Inner Left Sequence: gaccttttcacgaggcaatc. Inner Right Sequence: ggtccttcgacaaccatagc. Inner Primer PCR Length: 1314. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44G3.2 Homozygous. Outer Left Sequence: tgcacagattggtcttcgac. Outer Right Sequence: aggtccaaatgatgtcagcc. Inner Left Sequence: tttcaactctgtgtcttggca. Inner Right Sequence: ccgcattattcgttaagggt. Inner Primer PCR Length: 1144. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M02D8.1 Homozygous. Outer Left Sequence: gataaaccacttgccggaga. Outer Right Sequence: tgtgcatgggacacaaagtt. Inner Left Sequence: ccgatggagagaacagctcta. Inner Right Sequence: tcgaaaatcagaagcaacga. Inner Primer PCR Length: 1159. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09F9.2 Homozygous. Outer Left Sequence: aatccactgctccaacaacc. Outer Right Sequence: gtgactccatcctcctggaa. Inner Left Sequence: aagtgtgaacggggatgtct. Inner Right Sequence: aggtgtagccttcgatggtg. Inner Primer PCR Length: 1257. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16E9.2 Homozygous. Outer Left Sequence: tgttgctgaagcaattcgac. Outer Right Sequence: ccccctttgaaaacaagaca. Inner Left Sequence: gttggcaacacagcaaggta. Inner Right Sequence: cagctcgttctcctcgtttc. Inner Primer PCR Length: 1373. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40F9.2 Homozygous. Outer Left Sequence: tcgctactttcccgcttaaa. Outer Right Sequence: tttcagtttgccatcacagc. Inner Left Sequence: tcgtaattatttgtgaaatgaaactt. Inner Right Sequence: cagaaccgtttcaggattgg. Inner Primer PCR Length: 1253. Deletion size: about 800bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07C6.4 Homozygous. Outer Left Sequence: aattctctgctcgtcggaaa. Outer Right Sequence: tcaatatgcacacagcgaca. Inner Left Sequence: tcgaggccgaagataaggat. Inner Right Sequence: gctttttaggctttctcgtgg. Inner Primer PCR Length: 1143. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R08C7.6 Homozygous. Outer Left Sequence: acggaacatttttcaaggca. Outer Right Sequence: accccaccaatcaacgataa. Inner Left Sequence: gcgacatttgcacaattaca. Inner Right Sequence: gagttggacgccactgattt. Inner Primer PCR Length: 1201. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28C12.9 Homozygous. Outer Left Sequence: tcgtcgatcaatcctgacaa. Outer Right Sequence: cgttaatacttcgtggccgt. Inner Left Sequence: caacgaagactctagggcgt. Inner Right Sequence: cccggccatattatttttga. Inner Primer PCR Length: 1333. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R13H9.5 Homozygous. Outer Left Sequence: aatgaactcaaaacgggacg. Outer Right Sequence: tgtaatgacgcttgtcggaa. Inner Left Sequence: cggttccagtccagtctgat. Inner Right Sequence: agtctttgcaggtaaatacgagtt. Inner Primer PCR Length: 1218. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y113G7B.14 Homozygous. Outer Left Sequence: ggacccctgacatgaacttg. Outer Right Sequence: gtctcgaaagtcgtcttggc. Inner Left Sequence: tgtccgacaatgagaatgga. Inner Right Sequence: tttcatcatcggaacaagca. Inner Primer PCR Length: 1147. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y18D10A.19 Homozygous. Outer Left Sequence: agtcgaagctcacgattgct. Outer Right Sequence: cggagatttcgacttcaagg. Inner Left Sequence: ccgtagccaggagaaaaatg. Inner Right Sequence: ttatggagaggttgcacacg. Inner Primer PCR Length: 1148. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09D12.1 Homozygous. Outer Left Sequence: tcgtcatctttttgtcgctg. Outer Right Sequence: attgaaccaatagttgcggg. Inner Left Sequence: ttcttgtgttccaaaagggc. Inner Right Sequence: ttgagatagggtaaaagaagatcg. Inner Primer PCR Length: 1202. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38B6.6 Homozygous. Outer Left Sequence: aaacgtgtaccgagattcgc. Outer Right Sequence: tggtgaatggatttgaagca. Inner Left Sequence: aacaaaactgaagttggattcagaaacaaaactgaagttggattcaga. Inner Right Sequence: gggatgcatttcctccatta. Inner Primer PCR Length: 1214. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34F6.3 Homozygous. Outer Left Sequence: cctgccactaaagagaacgc. Outer Right Sequence: gcggaaacaaggattatgga. Inner Left Sequence: ggttgcaaagtgattgcaga. Inner Right Sequence: tggtaagaaacgttcacgca. Inner Primer PCR Length: 1291. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807