Search Strains

T05C12.2 Homozygous. Outer Left Sequence: gtcttcgtccagccaacact. Outer Right Sequence: ggctcctgttcaatctctgc. Inner Left Sequence: attccgatcgaagctgaaaa. Inner Right Sequence: ccatttcaatcgtccatgtg. Inner Primer PCR Length: 2213. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C38C10.4 Homozygous. Outer Left Sequence: ggaagagcattttcccatca. Outer Right Sequence: atatcagaaagcggcgctaa. Inner Left Sequence: gctggcagtctccatctctc. Inner Right Sequence: gatccgcgtgaaatttttgt. Inner Primer PCR Length: 2139. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18C4.2 Homozygous. Outer Left Sequence: gtgggtctcgaagggaattt. Outer Right Sequence: tgagattttcccgatccaac. Inner Left Sequence: aggtgagggaaaccacactg. Inner Right Sequence: tttcaatttttccgtcgtcc. Inner Primer PCR Length: 3299. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C8.14 Homozygous. Outer Left Sequence: taatatgagcaatgcgcgtc. Outer Right Sequence: ctacggtaggtggcggagta. Inner Left Sequence: gcgtacttcctcgtctaccg. Inner Right Sequence: gcggaatcaggtcaagtgtt. Inner Primer PCR Length: 3202. Estimated Deletion Size: about 2900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T04C12.5 Homozygous. Outer Left Sequence: tggcgagagaagaagagagg. Outer Right Sequence: aaacaatacctgattcggcg. Inner Left Sequence: gcgtgagaaacagtgcaaaa. Inner Right Sequence: aacatgacggtcagcaagtg. Inner Primer PCR Length: 2668. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.1 Homozygous. Outer Left Sequence: ttcaaatgcattgccaaaaa. Outer Right Sequence: ttggcaacaacaaagcagag. Inner Left Sequence: cctccgaattttcccatttt. Inner Right Sequence: aaagctgaaggatctgccaa. Inner Primer PCR Length: 2932. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16A11.4 Homozygous. Outer Left Sequence: ctaccaagaaaatcgccgaa. Outer Right Sequence: gtggaggcaccgtaacttgt. Inner Left Sequence: catagaaattccgccgaaaa. Inner Right Sequence: tctcgacgcgaaaaggttat. Inner Primer PCR Length: 2747. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18F3.2 Homozygous. Outer Left Sequence: accgggttctgctgtgtatc. Outer Right Sequence: gagaccagacaccgcatttt. Inner Left Sequence: tgggaagctccaatgatttc. Inner Right Sequence: atcaaaatttcgcatctggc. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.3 Heterozygotes are WT and GFP+. ok1281 animals arrest as larvae. Outer Left Sequence: gagcttctgcaggacacaca. Outer Right Sequence: ctgcgaagatgggaaaagag. Inner Left Sequence: tgaaaagctcagtgacggtg. Inner Right Sequence: ctcgtctgcatttttgcgta. Inner Primer PCR Length: 3153. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10G8.7 Homozygous. Outer Left Sequence: ggaaaacaaaaccagggtca. Outer Right Sequence: cacgatcaagaagaatgcca. Inner Left Sequence: gaacggttgttcccagaaaa. Inner Right Sequence: cccgtgcagaggaatctaaa. Inner Primer PCR Length: 2241. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10H11.9 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: tcaatgaagcgtcgaagttg. Outer Right Sequence: gatcgagataatgcgggaga. Inner Left Sequence: cgagttcacgagagagaccc. Inner Right Sequence: gccgaagacatttaacggaa. Inner Primer PCR Length: 3323. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17H12.9 Homozygous. Outer Left Sequence: agttcctctgccgcttgtaa. Outer Right Sequence: aagttcggggaatttcgtct. Inner Left Sequence: gcaaccacgtagcttcacaa. Inner Right Sequence: ttggaaatggaatcacccat. Inner Primer PCR Length: 3028. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17G10.4 Homozygous. Outer Left Sequence: cagtcgtggatgaacactcg. Outer Right Sequence: caccacaaatgactgttccg. Inner Left Sequence: gagacacttttctcggacgg. Inner Right Sequence: tgaatcgaaatcgtgaacca. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14B1.4 Homozygous. Outer Left Sequence: acgctgaagacgaggatgat. Outer Right Sequence: aatatcggcaattacgcagg. Inner Left Sequence: attgtgtgttcgctgtgcat. Inner Right Sequence: cgtatttgctctcggtcgat. Inner Primer PCR Length: 2239. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C12D8.1 Homozygous. Outer Left Sequence: aacatggctttttctggcac. Outer Right Sequence: aaagggaaaattgggcaaag. Inner Left Sequence: acggtgcaaacattggtaca. Inner Right Sequence: ttcgaccttgcttcgaaagt. Inner Primer PCR Length: 2264. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01C10.1 Homozygous. Outer Left Sequence: ctccggttgcatcagaaaat. Outer Right Sequence: cctgccaagctggtgttatt. Inner Left Sequence: tgttcaaatttttgctgcca. Inner Right Sequence: tttgtttgtcagcagtccgt. Inner Primer PCR Length: 2117. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14A11.7 Homozygous. Outer Left Sequence: ttctttcacccccttttcct. Outer Right Sequence: cgccttatttcagcttttgc. Inner Left Sequence: ttttgcaatcactctcgtcg. Inner Right Sequence: gcaaggaaggcattttggta. Inner Primer PCR Length: 2887. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17C3.8 Homozygous. Outer Left Sequence: ccagttccgcctgtaacatt. Outer Right Sequence: ttgccacgactggatattga. Inner Left Sequence: actcacctctgcaactgcct. Inner Right Sequence: agtgtcacacgctgagatgg. Inner Primer PCR Length: 2179. Deletion Size: 983 bp. Additional information from Casonya Johnson 3/2005: the deletion is 983 bases, from base 2254 to 3237 on the cosmid C17C3. The gene C17C3.8 is on the opposite strand, and its coding region is from bases 3237 to 3616. The deletion occurs within the second exon of the gene, so that the first 105 amino acids of the protein are still made. This region contains one of the two HLH domains produced by this protein but eliminates the second one. The first stop codon would allow another 19 amino acids to be added to the peptide. I have pasted the sequence below (the red, underlined sequences are the new nucleotides). MSSSPTSSSS GSPSSHGHRS ETEKQRRDDT NDLLNEFKKI VQKSESEKLS KEEVLFRIVK LLSGIQLHHE SFSTSPGPIR SIKKIKSDRE QVRRNKRVAA YRELR tiknkhlehvfnffelki stop Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C13G3.3 Homozygous. Outer Left Sequence: gatgtgcaaagagtggggtt. Outer Right Sequence: ttggtttgttacgcctttcc. Inner Left Sequence: aaagtcgcatttggatttgc. Inner Right Sequence: tttccccaacttcacgaaac. Inner Primer PCR Length: 2336. Estimated Deletion Size: about 550 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14F5.2 Homozygous. Outer Left Sequence: tggttacccatctgcgtgta. Outer Right Sequence: gcatgttccttcatttccgt. Inner Left Sequence: ttcgcgcacattttgagtag. Inner Right Sequence: gacaagatcattggcgaggt. Inner Primer PCR Length: 2296. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C11D2.2 Homozygous. Outer Left Sequence: aggccgattgcattgataag. Outer Right Sequence: ggggcaattttcaacaaaaa. Inner Left Sequence: ggtttgatcgacttgttggg. Inner Right Sequence: cccgatccgtttattcttga. Inner Primer PCR Length:3169. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28C12.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC116.3. Homozygous. Outer Left Sequence: TCCCAAAATTGGTGTCCATT. Outer Right Sequence: GAGCATGTCTCGGAACACAA. Inner Left Sequence: ACCCTTCGGCATATCTTCCT. Inner Right Sequence: TGCGAAAGGATATGGGAAAC. Inner Primer PCR Length: 3155 bp. Deletion Size: 1502 bp. Deletion left flank: GATTCAATTTTAAATAACGTAAGAGAGTAA. Deletion right flank: TCGATTCTCTGAACTTGTGGAAACACACAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1058.1 Homozygous. Diminished ablility to incorporate C14 labled propionate into protein (data provided by Randy Chandler). Outer Left Sequence: cgcgaaaattaacgagaagc. Outer Right Sequence: cagccaattttctgtgggtt. Inner Left Sequence: cggtcttcccaatttcttga. Inner Right Sequence: ttcccaaaatttcgttgctc. Inner Primer PCR Length: 3097. Deletion size: 990 bp. Left flank: TAGTCTCAAAATCAGATATACACAAAAATC. Right flank: ATGGCAAGTACTGGAACGACAGCTCCGTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.3 Homozygous. Outer Left Sequence: aaaatcgaaccacggtcttg. Outer Right Sequence: tctctgcgacaaatgtctgg. Inner Left Sequence: agggcacggaaatgtgatag. Inner Right Sequence: tactccctgtgtccctttgc. Inner Primer PCR Length: 2921. Deletion size: 905 bp. Left flank: AGGGGAAAAAGGGAAAAAACGGCTGAAATT. Right flank: TTTTTCCATTTCTAAACTCGCGTAGTTGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.2, T26C11.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.4. Homozygous. Outer Left Sequence: CCAGACATTTGTCGCAGAGA. Outer Right Sequence: AATTCAAAGTTCCGCCAAGA. Inner Left Sequence: AGTATTGGCACGGACGAATC. Inner Right Sequence: CAGATGGACATCAGCCATTG. Inner Primer PCR Length: 3154 bp. Deletion Size: 870 bp. Deletion left flank: CATCGATGTTTGAGTGTTCTGAAAATGTGA. Deletion right flank: TCCTCCATTATAGCCGTCTGAATCCACATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18E3.6 Homozygous. Outer Left Sequence: acagtcaacgtggagcaatg. Outer Right Sequence: cgtcataaactgctctggca. Inner Left Sequence: tcgcttcttggacaattcct. Inner Right Sequence: ccgtgtactcatcgtctcca. Inner Primer PCR Length: 3031. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02C12.1. Homozygous. Outer Left Sequence: AGGGGATGGGAGAGGAAGTA. Outer Right Sequence: TCGAATTGGTGTTGAAGCAG. Inner Left Sequence: GGCATCAAACACACGAATTG. Inner Right Sequence: TGACCTTGTGGAAATCCCTC. Inner Primer PCR Length: 2991 bp. Deletion Size: 1523 bp. Deletion left flank: CGTCACAAGATAAAACTAATCTCCAAGCTA. Deletion right flank: GGCCAAGATATCTGACCTGAAAATAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18H9.8. Homozygous. Outer Left Sequence: CTGCTGGTGTAGGACATGGA. Outer Right Sequence: ATCAATCAAAAAGATCGCCG. Inner Left Sequence: AAACACGCATCAACCACAAA. Inner Right Sequence: GGGTAAAACGACGGAAACAA. Inner Primer PCR Length: 3267 bp. Deletion Size: 1372 bp. Deletion left flank: ATTTGAATGGCGATATGTCGGATATTGAGT. Deletion right flank: CAATTGAGGATATGGAATTGGCGTTAAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18G1.5. Homozygous. Outer Left Sequence: TCTTCAACGCGTCTGTCATC. Outer Right Sequence: CAGGATCATCTCCGCAATTT. Inner Left Sequence: TTAATGGATCGCTCCCAAAG. Inner Right Sequence: CGTTTGTTTGCTTCCATGTG. Inner Primer PCR Length: 2808 bp. Deletion Size: 1433 bp. Deletion left flank: CTGAAAATGTGTTCTTATAATTTGATTTCG. Deletion right flank: AAGGTCACCAAGTCTCCAGTCAAGAAGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07C11.1. Homozygous. Outer Left Sequence: GGAAAACATCGTGTGCCTTT. Outer Right Sequence: GTCTCAAGGCGAGAAGTTGG. Inner Left Sequence: ATTTGCGCGAATAACTGGTC. Inner Right Sequence: GCCAAAGCTTATCCCATTGA. Inner Primer PCR Length: 2358 bp. Deletion Size: 1165 bp. Deletion left flank: AACCAACAATCATATTCCCACCGGCTGGTT. Deletion right flank: AATGAATTAAATCAAATTTCTGGAAATCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35C11.1. Homozygous. Outer Left Sequence: AGATGCCGACGTCAATTTTC. Outer Right Sequence: ACTGTTGGGCCATACTCGAC. Inner Left Sequence: AATTCGGCTCAAAAAGCTCA. Inner Right Sequence: AGGGACCGAAGAGTGGATTT. Inner Primer PCR Length: 2278 bp. Deletion Size: 1477 bp. Deletion left flank: GCGTTCCAAATTTTATATCAACGGTTGATG. Deletion right flank: AAATTAATTTACCAGTTTATTGTATTGTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53C12A.2. Homozygous. Outer Left Sequence: TGAGAATTTGGGAACATCGG. Outer Right Sequence: ATCAATCGTTCCATGCATCA. Inner Left Sequence: ATTTGCTCAGAAAACGGGAA. Inner Right Sequence: ATTCAGCCATCATGGGAATC. Inner Primer PCR Length: 2194 bp. Deletion Size: 1158 bp. Deletion left flank: TCTTCTCAGCTTCTGCAACGTCAGCATTCA. Deletion right flank: TAGTTAGTTTGCACTTGAGAAAATGTTGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18D11.2. Homozygous. Outer Left Sequence: TACTACGGAGAGACCCACGC. Outer Right Sequence: TTCGAAATGTCGGTGTTTGA. Inner Left Sequence: GCATTTTTCTTCCCCCAGTT. Inner Right Sequence: CAGGGTCTCACCACAAGTCA. Inner Primer PCR Length: 2684 bp. Deletion Size: 876 bp. Deletion left flank: GGCTTCATCCATCGTCATGTTGTCCAGCTT. Deletion right flank: TTAGTTTTACAATCGAGCCGCGACGCGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C13C4.5. Homozygous. Outer Left Sequence: AAAACCGACATGCACACTGA. Outer Right Sequence: TGCGAATGATTGACTGATGG. Inner Left Sequence: CAACTCCAACGGATTCACCT. Inner Right Sequence: AAGAGCAGACCCGCAATAAA. Inner Primer PCR Length: 2307 bp. Deletion Size: 951 bp. Deletion left flank: AAAAGGGAGAAATTGCTGCATCTACAGAAG. Deletion right flank: GCACTGAATCAAAATATTCATTTGCAGTGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57C12.4. Homozygous. Outer Left Sequence: GGCATCTTTTGCCATTGAGT. Outer Right Sequence: CACCTTCCACAGATCCAACC. Inner Left Sequence: TTGCGAGAAGGTTCTTTGGT. Inner Right Sequence: AACGTCTGGAATCCCATTTG. Inner Primer PCR Length: 3181 bp. Deletion Size: 1357 bp. Deletion left flank: GTTCAGACGATGTGCAATTGTTAGAACAGT. Deletion right flank: GCGCACCAAGGGTGTCGGTTTTTCGATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10G11.6. Homozygous. Outer Left Sequence: GACGAAGACGACGAAGAAGG. Outer Right Sequence: GGGGTACCCGATGAGCTACT. Inner Left Sequence: TTTACCACGGAAAACCTTCG. Inner Right Sequence: TTTTGGTGATTCATCGGGTT. Inner Primer PCR Length: 3386 bp. Deletion Size: 1357 bp. Deletion left flank: TTCCGTCTCCGTTTGTTCGAAAAATTCCCG. Deletion right flank: TTCCTCCGCCAGGACTCGTTGGAATCAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15F1.5. Homozygous. Outer Left Sequence: CACTCCGACAACAGGCAGTA. Outer Right Sequence: AGCACCGCAACTACCTCAAG. Inner Left Sequence: CGGAGTGTCGTTAGCCAGAT. Inner Right Sequence: GCCATCGTTCCATTTGTTCT. Inner Primer PCR Length: 3106 bp. Deletion Size: 1194 bp. Deletion left flank: TGTGTAATTAAATGAGCCGAAAAACTATAC. Deletion right flank: AACCAAGACTTGCAACATTTTTCAAGCAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53C10A.9. Homozygous. Outer Left Sequence: GTTGTTCTGGGTGCCTTTGT. Outer Right Sequence: TCCCAAAGAAACACGACTCC. Inner Left Sequence: CTTGCACAGTCGTGATGCTT. Inner Right Sequence: AGCGAGACCCTGAAAGTGAA. Inner Primer PCR Length: 2886 bp. Deletion Size: 2067 bp. Deletion left flank: TTGAGTTGACGGACAAACGGAATACATTGG. Deletion right flank: TAGAGCGGCGTTCGCGCCTCGCTCAGCTGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C12D8.1 Homozygous. Outer Left Sequence: aaagaagttgtggtgccgac. Outer Right Sequence: aatggaaggatttaacccgc. Inner Left Sequence: ccgttagccgaaaaattgaa. Inner Right Sequence: cgaatacttgtttgaacccca. Inner Primer PCR Length: 3085. Deletion size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C8.16. Homozygous. Outer Left Sequence: AAGACGACCACACTCTCGCT. Outer Right Sequence: ACACTGGGAAAAATGTTCGG. Inner Left Sequence: TGCCGATACTAAAGTTCCCG. Inner Right Sequence: GGACTACGGTAGGTGGCAGA. Inner Primer PCR Length: 3110 bp. Deletion Size: 1331 bp. Deletion left flank: ATTGTTCGAAAATTTGATGTCGGAATTGAA. Deletion right flank: GACTGTCAAAGCCGAGCTGAATGTGACGAA. Interpretation of sequence data is very speculative, and should be confirmed independently. Predominant band in PCR of mutants, about 600 bp, is probably not the full-length mutant product. Full-length mutant product is more likely a fainter band of about 1770 bp, which correlates well with deduced breakpoints and relative sizes of various bands produced by single-round amplification with external and internal primer pairs. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27C10.3. Homozygous. Outer Left Sequence: TTTACGGGGCTCGTATTTTG. Outer Right Sequence: TACAGTAATCCATGCGGCAG. Inner Left Sequence: GAGCCCGTAAATCGAGACAA. Inner Right Sequence: GGAACGGATTTCCGAATTTT. Inner Primer PCR Length: 2264 bp. Deletion Size: 1005 bp. Deletion left flank: GAATGAGCTCTTCACTGCTCAAACAAACTA. Deletion right flank: AGACTTCCGAAAGTGAATCACGTCTACCGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18B2.6. Homozygous. Outer Left Sequence: CGTTTAAAACACACCCCACC. Outer Right Sequence: GCTCAAAATGTTGGCGTTCT. Inner Left Sequence: CAGCTCCAGTCCTCATGTCA. Inner Right Sequence: CATTTCCCGTTTCCTTTTCA. Inner Primer PCR Length: 3228 bp. Deletion Size: 2211 bp. Deletion left flank: CCGACTGTGTGACGTACTATTTCTGCGACG. Deletion right flank: AATATTCTCGAAAGGCAGATCCATGGACGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18B2.6. Homozygous. Outer Left Sequence: CGTTTAAAACACACCCCACC. Outer Right Sequence: GCTCAAAATGTTGGCGTTCT. Inner Left Sequence: CAGCTCCAGTCCTCATGTCA. Inner Right Sequence: CATTTCCCGTTTCCTTTTCA. Inner Primer PCR Length: 3228 bp. Deletion Size: 1608 bp. Deletion left flank: ATAGTATATGTCAAGTATAATTTTTCGTTT. Deletion right flank: ATGTTTCTCGTAATAGATATAAGCTGTCGT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18H2.2. Homozygous. Outer Left Sequence: AAGTTGGAACCTTGGAGCCT. Outer Right Sequence: ACAGCGTCGTTGAAAGATCA. Inner Left Sequence: AACTGCTCCCATGTGACCTAA. Inner Right Sequence: CACTTCTGAAAATTCCACCGA. Inner Primer PCR Length: 3037 bp. Deletion Size: 1531 bp. Deletion left flank: TATTTTTCGTGTAACAATCTATTTTTCGTGGAACAATCTATTTTTCGTGTAACAATCTA TTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATT TTTC. Deletion right flank: ATCATCTTTGGATGTGACCAGCGCTGAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10H11.1. Homozygous. Outer Left Sequence: GCGCCGAAAAAGTACAAAAA. Outer Right Sequence: AGTAATGACGGTTTCACCGC. Inner Left Sequence: TTGTGCAGGAGAAACGTGAG. Inner Right Sequence: TGCATCGTTCTGTTTCCAAG. Inner Primer PCR Length: 3296 bp. Deletion Size: 2472 bp. Deletion left flank: GGATCGAAGAATGTCGATGTGAGACTTGTA. Deletion right flank: GTTGTGTACAAAGGAGCAGAACCTGAGCAG. Insertion Sequence: CT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18H7.2 Homozygous. Outer Left Sequence: aaccgcgcaaatgagtagat. Outer Right Sequence: gctccccctacttttgaacc. Inner Left Sequence: attcgggtcattgcttgaaa. Inner Right Sequence: aaggcactgattggttcagc. Inner Primer PCR Length: 3107. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807