Search Strains

More Fields
Strain Species Genotype Add
TG2932 C. elegans tdpo-1(gk889420) IV. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG2978 C. elegans rev-1(gk924750) II. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG3320 C. elegans apn-1(cxTi10435) II. Show Description
Superficially wild-type. Deletion site verified by PCR. Mos transposon insertion into apn-1; insertion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG3525 C. elegans fnci-1(tm3081) I. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG3527 C. elegans fncm-1(tm3148) I. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG3796 C. elegans bub-3(gt2000) II. Show Description
Y54G9A.6. Nonsense C to T transition. IR sensitive. To genotype: WT left mismatch primer: GAAACAGGCAACGGAACAC; mutant left mismatch primer: GAAACAGGCAACGGAAACT; right mismatch primer: CTCTTCATCATCTCCTCTCC. WT and mutant amplicon: 407 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885.
TG3867 C. elegans xpg-1(tm1670) I. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. 2020 bioRxiv, https://doi.org/10.1101/2020.06.04.133306
TG3880 C. elegans rev-3(gk919715) III. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
TG3967 C. elegans bub-3(ok3437) II Show Description
Y54G9A.6. IR sensitive. To genotype: External left primer: GTCCCGTTTCCCCCATTTG. External right primer: CTCTTCATCATCTCCTCTCC. Internal right primer: CTCCTCCGAACGCTACTT. External WT amplicon: 1970 bp. External mutant amplicon: 1635 bp. Internal WT amplicon: 1534 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885. Kim T, et al. J Cell Biol. 2015 May 25;209(4):507-17.
TG3969 C. elegans san-1(ok1580) I. Show Description
ZC328.4. IR sensitive. External left primer: AACAAGAAGGGGAAGAAAGA. External right primer: TGTCTCATCGAAATCCAACT. Internal Left Sequence: AGGAAGAAACGAGAAAAGCA. External WT amplicon: 1420 bp. External mutant amplicon: 428 bp. Internal WT amplicon: 720 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885.
TG4094 C. elegans unc-119(ed3) III; cxTi10816 IV; otIs433 V; gtEx4094. Show Description
otIs433 [dat-1::NLS::RFP + ttx-3::mCherry] V. gtEx4094 [glit-1p::GFP::glit-1 3'UTR + myo-3p::mCherry]. Pick animals with red fluorescence in body muscles to maintain. Transcriptional glit-1 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.
TG4100 C. elegans vtIs1 V; glit-1(gt1981) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. gt1981 is a point mutation in a highly conserved residue. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.
TG4103 C. elegans ttr-33(gt1983) vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.
TG4267 C. elegans lem-3(gt3309[eGFP::Stag::lem-3]) I. Show Description
GFP tag inserted into endogenous lem-3 locus by CRISPR. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.
TG4281 C. elegans unc-119(ed3) III; cxTi10816 IV; gtEx4170. Show Description
gtEx4170 [ttr-33p::GFP::ttr-33 3'UTR + myo-2p::mCherry + myo-3p::mCherry]. Pick mCherry+ animals to maintain. Transcriptional ttr-33 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.
TG4298 C. elegans lem-3(gt3310[eGFP::STag::lem-3[S192A S194A]]) I. Show Description
Endogenous lem-3 locus carries GFP tag and two misense mutations in putative phosphorylation sites [S192 S194]. Homozygous viable, though [S192A S194A] mutants exhibit increased embryonic lethality after irradiation. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.
TG4319 C. elegans lem-3(tm3468) I. Show Description
Homozygous viable. Increased embryonic lethality after irradiation.
TH113 C. elegans let-99(dd18) IV/nT1 [qIs51] (IV;V). Show Description
let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation.
TH26 C. elegans unc-119(ed3) III; ddEx10. Show Description
ddEx10 [pie-1p::GFP::sas-4 + unc-119(+)]. Maintain by picking non-Unc.
TH27 C. elegans unc-119(ed3) III; ddIs6 V. Show Description
ddIs6 [tbg-1::GFP + unc-119(+)] V.
TH32 C. elegans unc-119(ed3) ruIs32 III; ddIs6 V. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V.
TH48 C. elegans mbk-2(dd5) IV. Show Description
Recessive temperature sensitive maternal effect lethal. Maintain at 15C. At 16C: dd5 animals produce 90% viable embryos. At 20C: dd5 animals produce 56% viable embryos. At 25C: dd5 animals produce 2% viable embryos.
TH61 C. elegans unc-119(ed3) III; ddIs36. Show Description
ddIs36 [pie-1p::GFP::sas-5 + unc-119(+)].
TH65 C. elegans unc-119(ed3) III; ddIs15. Show Description
ddIs15 [C47B2.3(genomic)::YFP + unc-119(+)]. Alpha tubulin::YFP.
TJ101 C. elegans Show Description
No fertility at 25C.
TJ103 C. elegans Show Description
No fertility at 25C.
TJ104 C. elegans Show Description
No fertility at 25C.
TJ105 C. elegans Show Description
No fertility at 25C.
TJ1052 C. elegans age-1(hx546) II. Show Description
Long life. Normal fertility. Not Temperature sensitive. Stress tolerant.
TJ106 C. elegans Show Description
No fertility at 25C.
TJ107 C. elegans Show Description
No fertility at 25C.
TJ108 C. elegans Show Description
No fertility at 25C.
TJ112 C. elegans Show Description
No fertility at 25C.
TJ121 C. elegans Show Description
No fertility at 25C.
TJ123 C. elegans Show Description
No fertility at 25C.
TJ127 C. elegans Show Description
No fertility at 25C.
TJ131 C. elegans Show Description
No fertility at 25C.
TJ146 C. elegans Show Description
No fertility at 25C.
TJ202 C. elegans Show Description
No fertility at 25C.
TJ207 C. elegans Show Description
No fertility at 25C.
TJ215 C. elegans Show Description
No fertility at 25C.
TJ225 C. elegans Show Description
No fertility at 25C.
TJ236 C. elegans Show Description
No fertility at 25C.
TJ239 C. elegans Show Description
No fertility at 25C.
TJ242 C. elegans Show Description
No fertility at 25C.
TJ246 C. elegans Show Description
No fertility at 25C.
TJ251 C. elegans Show Description
No fertility at 25C.
TJ257 C. elegans Show Description
No fertility at 25C.
TJ264 C. elegans Show Description
No fertility at 25C.
TJ265 C. elegans Show Description
No fertility at 25C.