Search Strains

C43H6.7. External left primer: ATCTTCATATTTGACCGGCG. External right primer: TCCATTCTGCTTCGTCACTG. Internal left primer: ACCATCACCAGAAGAATGCC. Internal right primer: GGTCAAAGCTGCGAACTCAT. Internal WT amplicon: 2524 bp. Deletion size: 438 bp. Deletion left flank: GCTTTGTAGTAATGATATTGGATGTTGAAT. Deletion right flank: TTTTCGTAATTACTACAGTGTTCTCAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53C10A.15. External left primer: ATACAATGCGCCATGTTTGA. External right primer: CGGTGTGAATGGTCAATGAG. Internal left primer: ATTCCCACGTGGAGTCAGAA. Internal right primer: AAGTTGTTTGAAATGCCGCT. Internal WT amplicon: 2020 bp. Deletion size: 1162 bp. Deletion left flank: CGTCTCACCTGATTTCGCATGGTTAAGAAC. Deletion right flank: CTTCGAATCTTTTGACTGCTTCAATGTGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y116A8C.20. External left primer: ACGCTGTAAAAAGAAGGCGA. External right primer: TGAGCACGTTTTTGAAATGC. Internal left primer: AGCGGCTGAAGAGAAGTTTG. Internal right primer: GACTGACGCAGTGACAGGAA. Internal WT amplicon: 1414 bp. Deletion size: 378 bp. Deletion left flank: ATGGGCGGAGCTTCCCGATCAATAATTGAC. Deletion right flank: CAATTACCCTCCATCCCTTTCACATACATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26D10.9. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G8AR.1. External left primer: GTTTTCCTAAAGTTCGGCCC. External right primer: CCCTTTCACTTTTCACCGAA. Internal left primer: CATAAGCTCGATCCCAAAGC. Internal right primer: CTTTGAATCGCGGAATTTGT. Internal WT amplicon: 3012 bp. Deletion size: 786 bp. Deletion left flank: CAATGTCGATTGGCTCGTTTTTGAATTCTA. Deletion right flank: AATAGTTAAAGTCCAATTCATTGTTTATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71A12B.8. External left primer: TCAGGTGAGATGTCTGCGTC. External right primer: CTCGGCAATGTTTTCCAAAT. Internal left primer: CTGCCATACCTGGACGATCT. Internal right primer: CCCTATCCTATGCCTACGCC. Internal WT amplicon: 2070 bp. Deletion size: 610 bp. Deletion left flank: GGTATTGGAATATTTGAAACTTGATTTGGT. Deletion right flank: TTATGCTTAGTCTTAAGCTTAGGCTTAGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C39D10.7. External left primer: TTTGCATGTATCCACGGTGT. External right primer: TAAGCAGCGGAAACCATTTT. Internal left primer: GGGGCACATGAGGAAATAAG. Internal right primer: TTTCAAACAAAAATTCCCCC. Internal WT amplicon: 1179 bp. Deletion size: 691 bp. Deletion left flank: CAGATAACTTGTGATTTTGCACAGTCTAAC. Deletion right flank: TAGAGTTGTTGTGAAGATTGTTGATGTGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C47D2.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38E11.7. External left primer: ATGGCCATTGACTCTTCTGG. External right primer: GAAGAAGACTTTGGGAGGGC. Internal left primer: TTACGCGCAAAATTTCCTCT. Internal right primer: TTCGCGGTCATTTTCATTTT. Internal WT amplicon: 1168 bp. Deletion size: 688 bp. Deletion left flank: GATTTGAGATAACTTGTTTTAGGGAAACTT. Deletion right flank: GGTTTTGAACACATTAATCGAACCACTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y69A2AR.29. External left primer: ATTTCCGACGACGAACTGTC. External right primer: ATCTCCAGACTGGTGTTCCG. Internal left primer: CAAAGTTGGTGGCCTAGGAA. Internal right primer: ATTCTACCCGCATCATTTGC. Internal WT amplicon: 2637 bp. Deletion size: 2266 bp. Deletion left flank: TGACGACTTCTATTTGATGGCCTAACTTCC. Deletion right flank: AATTGTAAGGCTAATGAAGCAATGAAAAAA. Insertion Sequence: AGAGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06B8.7. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 540 bp. Deletion left flank: AGCCAACGGCATGCTGGTTATGCTCACCTT. Deletion right flank: TGTGACTTAAGACTTTCTGGCAATGATTCT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3D.6. External left primer: TCGAATTGCATTTTGACAGC. External right primer: CGAAAAACAAGCAGCACAAA. Internal left primer: ACACGAATGCATAATTGCCA. Internal right primer: TACCGCCCAGTTTCAAGTTC. Internal WT amplicon: 2013 bp. Deletion size: 1085 bp. Deletion left flank: TCTGGGCTTCACTGATTGGGGTTAACGATT. Deletion right flank: CTTTATTAGACTCAAAGTTGTCTGAAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0041.7. External left primer: GAGTCATTCGAGCCAATGGT. External right primer: TCCGAAAAAGAAGAAGCCAA. Internal left primer: TTTACGCAGCAAATCAGCAG. Internal right primer: TCTGTTTGACGGGTACACCA. Internal WT amplicon: 3252 bp. Deletion size: 1353 bp. Deletion left flank: AAACGATAGACACGGAACAGAGATTGAGTG. Deletion right flank: CTTCTTCCTCTGCATCTTCTCTCATTACTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25H5.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W07A8.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F27F2.1. External left primer: TACGGATTGGAAAGCTCGAT. External right primer: AATGCTTCTGGCTTGTTGGT. Internal left primer: AACAAAATCTAACAGCCGCC. Internal right primer: TGAAAGATGCTCGCAAACAC. Internal WT amplicon: 3353 bp. Deletion size: 1242 bp. Deletion left flank: AGCACCTGCTCAATATATCAGATACACTCC. Deletion right flank: TTCATTTTTTCTAAATTTCGAACCGCCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F02D8.2. External left primer: ATCAATGTCCGCCAGCTTAC. External right primer: ATGTCCATCATGCACTCCAA. Internal left primer: CGGAATTATAATCCTCCGCA. Internal right primer: AGCCGGATACATTTGAGTTCT. Internal WT amplicon: 1104 bp. Deletion size: 597 bp. Deletion left flank: TCATATGCTATGCCAAAATACGCAGTTGCT. Deletion right flank: GGAAAGGTATTATTCACATATCTACTTATC. Insertion Sequence: TCCCAATATGCAATGGTTCCATATCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02E11.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73B3A.5. External left primer: TTCGTCAAAGTCAGTCAGCG. External right primer: AGGGCACTTTTTGTCTGCAC. Internal left primer: GAGAGCGTGCCATATTGGAT. Internal right primer: ACTACTGACGCCCACACTCC. Internal WT amplicon: 2261 bp. Deletion size: 697 bp. Deletion left flank: TATGTTTTTCTAAAAGTAAGATTCATTTTC. Deletion right flank: GATTTTCTCGACGATTTTTGGATTTTCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T25G12.4. External left primer: GGGGAAAGTGTTCACTGCAT. External right primer: GCGTTGCTTTTCGTCTTTTC. Internal left primer: TCTTTTCCGTGCCTTACACC. Internal right primer: TCCCCATCATTTTTCGTGAT. Internal WT amplicon: 2461 bp. Deletion size: 847 bp. Deletion left flank: TTATTTTGTCTCGTGTTCGTGTTCCTCTTG. Deletion right flank: ATGTAATCATCATGTTGGTCGGCAACAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R74.5. External left primer: TGGATTGTGAAAACCCCCTA. External right primer: GATGCAGAGCCTGTGAGTGA. Internal left primer: TGCGCCCCCATAATAAATAA. Internal right primer: GCAGCGACTTGATTTTGTGA. Internal WT amplicon: 3250 bp. Deletion size: 1611 bp. Deletion left flank: TCTTTCAATCTTTCATTTCTAACCGATTTC. Deletion right flank: TCAGGTAAGGAAAATAGTGTTTCGTGATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07A1.13. External left primer: TTACGCGATGCGATTCAATA. External right primer: GACGACGGGCATCTGTAAAT. Internal left primer: CCAATTATTCCAATAAATACGAAAC. Internal right primer: GTGGTTTCATTCTCGTATCTCAG. Internal WT amplicon: 1198 bp. Deletion size: 516 bp. Deletion left flank: TCTCGTATCTTGCCATGTAGATGTAATGCA. Deletion right flank: AAAGTTTTGAGTTATTTCATATCGAGCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12H6.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E02A10.2. External left primer: TCGACCTTCTCGCTCTTTTC. External right primer: GAGGAGGAGGTGGAGGATGT. Internal left primer: CGACCTCATCTTCCTTCTTTTC. Internal right primer: CGCCAGTTAAGATGGTTTGG. Internal WT amplicon: 1228 bp. Deletion size: 583 bp. Deletion left flank: CTTGCGTCCACATCCACCACCGCATCCTCC. Deletion right flank: ACCTCCTCCTCCACCTGTAAATCAAATAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01G12.1. External left primer: CTGCTGCGTTTTTCGTATCA. External right primer: AAGAGCGAATGGATTTGGTG. Internal left primer: TCAGTCTGATCATTTTTCCTTCAA. Internal right primer: TGATTGGTCGGTCATTCAAA. Internal WT amplicon: 1166 bp. Deletion size: 532 bp. Deletion left flank: ACGTCGATTGCTTTTTGACTTCGCAGAAAT. Deletion right flank: ACAAAGTGGCACAACTATAAAAACGCCAGGAAGCACTATTTGCATGACTAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40F9.7. External left primer: CCGTACAGCTGCATCAAAGA. External right primer: GTGTGGGTCGGTAATGGTTC. Internal left primer: ATCACTCGTCTTTACGCGCT. Internal right primer: ATCAACTCGCGATCCTTGTC. Internal WT amplicon: 2178 bp. Deletion size: 568 bp. Deletion left flank: ACATACAGAACATATAGAACATAACACACT. Deletion right flank: ACTCGTTAGTTTTGACCTTATCTTTTAGGG. Insertion Sequence: AAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38H8A.4. External left primer: CACTTCCCCCAGTTTTTGAA. External right primer: GATCAACATCACTCCGACCC. Internal left primer: CCACCTTTAAAATTGGGCAG. Internal right primer: GTGAAAAAGATGACTACATCAAGAA. Internal WT amplicon: 1314 bp. Deletion size: 551 bp. Deletion left flank: CCCCTTCTTATCCATGATGTCTCTTGCTAT. Deletion right flank: GCACAATGTTATATGATTGGAGATGCTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19B4.1. External left primer: GGCATGTAGGCAGACAGTCA. External right primer: CAAACCTTGCATCCCAAACT. Internal left primer: CAGTTGCATTTGAACCGATG. Internal right primer: TTCCAGCTCTTTGGAAAACG. Internal WT amplicon: 1163 bp. Deletion size: 519 bp. Deletion left flank: CAAGATGGAATAAAATATTTTGTGCTCCAA. Deletion right flank: AAATCTAAAATAGTCAATTTTAAGAAAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y65B4BR.8. External left primer: TAAAGGCGCACACATTTTCA. External right primer: GTTTTTGCAGCAGCCTTTTC. Internal left primer: AAAATTTGTCGTGCCGAGAT. Internal right primer: TTACAGAATGGTGGGTTTGAA. Internal WT amplicon: 1278 bp. Deletion size: 465 bp. Deletion left flank: AATCGTTCCAATTGTTTCCAGGTAATGGCT. Deletion right flank: TCGCACGATGCCTTGTCTCCACACTTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54G2A.20. External left primer: TCGCAATGAGTGTTCTCCTG. External right primer: CTCATTCCCTGAACTCTCGC. Internal left primer: GGACAGGCCGCATACATATT. Internal right primer: ATCTCAAGAACGTTCACCGC. Internal WT amplicon: 2280 bp. Deletion size: 855 bp. Deletion left flank: TAATCTGATACGATTCTACCTGATATCTTG. Deletion right flank: AATGGTTGAGAACTGACGCTTTGGATGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C35D6. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 204 bp. Deletion left flank: TTACTATTACTTTTCGATCCCGCCACTTTT. Deletion right flank: ATATGTTACTGTTTTCTATTTTGTTTTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73B3A.7. External left primer: TTCGTCAAAGTCAGTCAGCG. External right primer: AGGGCACTTTTTGTCTGCAC. Internal left primer: GAGAGCGTGCCATATTGGAT. Internal right primer: ACTACTGACGCCCACACTCC. Internal WT amplicon: 2261 bp. Deletion size: 1045 bp. Deletion left flank: AAAGCGGGAATTTTTAATTTTCAATGCACA. Deletion right flank: TTCATTGATTTTTGCTCAAATCATTATCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48A6C.1. External left primer: GGGTTTTCAGCCATTTTTCA. External right primer: AATTTCAATCAGAAACGCGG. Internal left primer: TTGTATCGATTAATCCCGGC. Internal right primer: TTTCGTCCGAACCGTTAGTC. Internal WT amplicon: 2443 bp. Deletion size: 1511 bp. Deletion left flank: GATGTCCTTTCTCTTTTCCTTCTCAACAAA. Deletion right flank: GGTCAAAAAAATTATTACACATTCCCGCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08A10.1. External left primer: TTTCACAACTACCGCCCTTC. External right primer: AAAAAGAAGCGAACGAACGA. Internal left primer: GATGATTGGATGGTTGCCTT. Internal right primer: CCGACGTGATGATTACGCTA. Internal WT amplicon: 1193 bp. Deletion size: 546 bp. Deletion left flank: CTTCCAATCGAGTTCATAGCTCCATTTATG. Deletion right flank: AATTTCATGCAAGACACTCAACTTACTAAG. Insertion Sequence: TTTTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09F5.1. External left primer: GTGGAGCAAATCGAGGTCAT. External right primer: CCACACAAGAATGTGTTGGC. Internal left primer: GCATCGAATAATTGAAGAGGG. Internal right primer: CCACGTCTTCTCTAGTGGGC. Internal WT amplicon: 1262 bp. Deletion size: 403 bp. Deletion left flank: TTTACTTTTCGGCACGTGGCGTCAGAGTGT. Deletion right flank: ATGATATTCACGAAGTGCGCACTGATGGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK470.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18H9.8. External left primer: GATGCCTGTGTCAAGAGCTG. External right primer: CCACTTCAACCTTGCCAACT. Internal left primer: GGACCTCCAAGAGCACCTACT. Internal right primer: ACGCACAATTCCATGAAGAA. Internal WT amplicon: 1310 bp. Deletion size: 488 bp. Deletion left flank: ACATTTTCCAGACTCCCGTCAAGTATTTGA. Deletion right flank: AGCTTTTAAGAGAAAGAGTTGTAGAAATGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27B7.7. External left primer: CATGACGTCGGTTACACTGG. External right primer: CTCCGGGTCCTGAAACATTA. Internal left primer: GCCAAATCTGTTTGAAGAACTG. Internal right primer: GCATGGATTCGTGTCTTCCT. Internal WT amplicon: 1144 bp. Deletion size: 409 bp. Deletion left flank: CTCTTTTCTAAAATAAAATATTGGTGTTCA. Deletion right flank: TGGAATATTTTGAAGTTCTCTCTTATAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10B3.7. External left primer: ATGACGGACAATCACAACGA. External right primer: GAAACTGCTTCAACGCATCA. Internal left primer: GGCCTTGGTAGCAATGTAGG. Internal right primer: GACCAAGCCAAGTGTCGG. Internal WT amplicon: 1117 bp. Deletion size: 851 bp. Deletion left flank: TGACAAAGTGTGGGTTGAGTGAGATGGATG. Deletion right flank: TGAGTGGAATCGTACTGGAACAAGTAGACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D5.3. External left primer: TTGGCTTTGCAGGAGCTAAT. External right primer: CAAAATGCAGCGAAAAACAA. Internal left primer: CACCGATGACACTGGTCACT. Internal right primer: CAATTTGGCCGGAGATTTTA. Internal WT amplicon: 1165 bp. Deletion size: 455 bp. Deletion left flank: CTATTTAATAAGCTTCGTTACCAACTTCTG. Deletion right flank: CAAGGTTCGAATTGGATTTTTTTTAACTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0250.4. External left primer: CCTGACGGGATGTGCTTAAT. External right primer: AACCAATGAATCCAACGGAA. Internal left primer: ACCAGTTTGGTGCGAAATGT. Internal right primer: AAATCCACGGAACCATTGAA. Internal WT amplicon: 2200 bp. Deletion size: 384 bp. Deletion left flank: AACACATTTTCTCTTGGCAATAGAAGGTAT. Deletion right flank: TCACATTTTTTATTGATTCAAAAAATTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 406 bp. Deletion left flank: CCACTCCAGTTCCATTCCCTCCATCTCCAA. Deletion right flank: GAAATCTGCCGAGAGACTATTCACAATGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23F11.1. External left primer: GAGACCCACTCGCTAACCAC. External right primer: GCGGGATGAACAATAGAGGA. Internal left primer: CTTCTGTCTCTCGGAAACGC. Internal right primer: CGAAAGGTATTTCAACCGGA. Internal WT amplicon: 3253 bp. Deletion size: 1421 bp. Deletion left flank: GAAAGTTATCAGAGCAAAAATGTGATAAAA. Deletion right flank: CTGACAAGCTGACACCGGATCACGAGTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16B12.5. External left primer: AATTGTACGGCGGAAAACTG. External right primer: ACCACGGTTGCATAGGACTC. Internal left primer: CTTGGCAAGACAAATGATCG. Internal right primer: CTGGACGGGTCAGTTTCAAT. Internal WT amplicon: 2766 bp. Deletion size: 1271 bp. Deletion left flank: GCATTTGGTCTCAATGAAAAAAAGAATCAG. Deletion right flank: TTAATTAGTACCACATTTAGGATGCAAAAA. Insertion Sequence: AAAAAGAAAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09H9.7. External left primer: TTGTGGAAACGGCTTAGACC. External right primer: AAACATTTCGAATTACGCCG. Internal left primer: GCGGTGAATCAGGAGATGAT. Internal right primer: TTTCAGGAAACCAGCGATTC. Internal WT amplicon: 1078 bp. Deletion size: 246 bp. Deletion left flank: TTCTTCGTCTGCGGTGAATCAGGAGATGAT. Deletion right flank: ACCTTAATATATCAATTAATAAAGGTATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59D12.1. External left primer: CTCACAAAAAGGGGCGAATA. External right primer: TACCCCTTACACTAACGGCG. Internal left primer: GGTTGTGTTCTATCCCGACG. Internal right primer: ATGAGTGCTTGGGACTTTGG. Internal WT amplicon: 937 bp. Deletion size: 198 bp. Deletion left flank: CTTTAACACAGGCTGGAAAATCTGGTCAGC. Deletion right flank: CCATTTGATATGGATTTATCAATGGTAAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50F4.7. External left primer: GATCCAGAGCTTCTCGCAGT. External right primer: ACAATTCCAGGTGGACAAGC. Internal left primer: TCTTCACCGTCTTTCCGAAC. Internal right primer: ATGGTTGGTAGCCACTGCTT. Internal WT amplicon: 820 bp. Deletion size: 317 bp. Deletion left flank: TCGTTTTCTAACAACTTTTAATCATGTCTG. Deletion right flank: CGATGGACGTTGTCTATGCCTTGAAACGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54G7,4. External left primer: ACAATCGGAAAATTGCCAAG. External right primer: TAGATTACGCGGAGCGAAGT. Internal left primer: TTCCATATCGTGACACAGCG. Internal right primer: CCACGCCCTCAGTAAGGTAA. Internal WT amplicon: 2412 bp. Deletion size: 679 bp. Deletion left flank: TGATTTGCATCAGCGATGAATTGTGCTTTC. Deletion right flank: CACACTCAAAACCTTTCAGTACTTCATTAG. Insertion Sequence: GTGTGACCAAGCTGTTGAATGCTATTTAAGACGGAGCCTGCCACAGAAAGCATTGCACG CGTGTAAAGAGCTGAATCAGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42E11.1. External left primer: TGGACTTGCATGGAACACAT. External right primer: AATCATTTCTTCACGGGCAC. Internal left primer: ACACTACAACTTACCCGCCG. Internal right primer: GGTGGTGTCATCTTTGGCTT. Internal WT amplicon: 2647 bp. Deletion size: 1230 bp. Deletion left flank: ACCACAAAATAATGTTTTCATTTTTAACTT. Deletion right flank: CTTATCCAACTAGACCTGACGTCAAAATTT. Insertion Sequence: TCAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20G5. External left primer: ATCAACCGGAGAACACGAAC. External right primer: AACCTGTTTGAATCGAACGC. Internal left primer: GCAAATGCACTAGATGCGAA. Internal right primer: GATTGGACGTGATGGAGGTT. Internal WT amplicon: 1084 bp. Deletion size: 306 bp. Deletion left flank: AAACCTTCATATCTTCCATTACTAATAGGT. Deletion right flank: TTCGTTCCGCTCTTTTCCGAAAGGGATTTC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807