Search Strains

Aldicarb resistant. Unc. A65G mutant (C to T in second base of codon).

No obvious phenotype.

ltSi1112 [cyb-1p::cyb-1::mNeongreen::cyb-1 3'UTR + Cbr-unc-119(+)] I. CYB-1::mNG reporter using its own promoter and UTR. Single-copy transgene insertion in Chromosome I using MosSCI. Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.

mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1129 [spd-2p::spd-5(re-encoded) + Cbr-unc-119(+)] II. Re-encoded spd-5 is siRNA-resistant. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1219 [spd-2p::spd-5(S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. Small centrosomes. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1232 [spd-2p::spd-5(S170A T178A T198A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi1539 [spd-2p::GFP::spd-5 S170A T178A T198A::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled microtubules. GFP-labeled centrosomes. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1561 [spd-2p::spd-5(S170A T178A T198A S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi264 [bub-1p::bub-1(re-encoded)::RFP + Cbr-unc-119(+)] II. BUB-1::RFP has been re-coded to be knl-1(RNAi) resistant. Reference: Pelisch F, et al. Mol Cell. 2017 Jan 5;65(1):66-77. doi: 10.1016/j.molcel.2016.11.001. PMID: 27939944

otEx4548 [tbb-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. otEx4445 [snb-1::NLS::RFP + pBX]. Rollers. Maintain by picking RFP+ Rollers. Maintain at 20C to maintain extrachromosomal array. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.

otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx6254 [snb-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx6254. Ubiquitous nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. Derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6747 [tab-1(fosmid)::SL2::YFP::H2B + rol-1(su1006)]. Pick Rollers to maintain otEx6747. Him. otIs549 reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. otIs549 was derived from injection of pMG154; line 2-1. otEx6747 reporter tag inserted into fosmid WRM0617bA03; line 5-4. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otEx6799 [gab-1(fosmid)::SL2::NLS::YFP::H2B + ttx-3::mChopti + pha-1(+)]. Maintain at 25C to select for array. Reporter tag inserted into fosmid WRM0640aC06. Line 2-3. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otEx6803 [gab-1p::GFP + pha-1(+)]. Maintain at 25C to select for array. Reporter contains 5 kb of gab-1 promoter fused with GFP. Derived from injection of pMG250; line 1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6804 [tab-1(+) + ttx-3::GFP]. Maintain otEx6804 by picking ttx-3::GFP. otEx6804 carries a PCR fragment containing the tab-1 locus; rescues gk753. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otEx7202 [gbb-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

CRISPR-engineered T2A::GFP::H2B insertion specifically tags isoform b.1 of the endogenous unc-25 locus. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.

oyIs14 [sra-6::GFP + lin-15(+)]. otEx1267 [pTB71=egl-15p::egl-15(5B) genomic hybrid + ceh-22p::GFP + pBS]. otEx1267 rescues the lethal phenotype of egl-15(n1456).

bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped.

rhIs4 [glr-1p::GFP + dpy-20(+)] III.

bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped.

oyIs14 [sra-6::GFP + lin-15(+)].

oyIs14 [sra-6::GFP + lin-15(+)].

zdIs13 [tph-1p::GFP] IV.

zdIs13 [tph-1p::GFP] IV.

cuEx828 [ceh-19p::snb-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. SNB-1::GFP expression specifically marks synaptic vesicles in the MC pharyngeal neuron. Reference: Kozlova AA, et al. Genetics. 2019 May;212(1):231-243. doi: 10.1534/genetics.119.302053. PMID: 30898771.

Heterozygotes are WT and segregate WT, DpyUncs, and peb-1(cu9) homozygotes which arrest as larvae with a stuffed pharynx, abnormal hindgut and g1 gland cell morphology, and molting defects.

Superficially wild-type. Reference: Milton AC, et al. Dev Biol. 2013 Oct 1;382(1):38-47.

wgEx360 [peb-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs385 [F55B11.4::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

Bacteria. Kanamycin-resistant E. coli. cytR- mutation in OP50 background causes elavated nucleotide levels similar to HT115. A mutation in CytR- was introduced into the OP50 strain by recombineering. Bacterial cells were transformed with pSIM8 plasmid before using as hosts for recombineering. Targeting substrate DNA fragments were amplified by PCR and subcloned into TOPO cloning vector for sequence verification before being electroporated into the host bacterial cells. The primer set used for cloning targeting cytR substrate DNAs (to replace cytR+ with the cytR- mutation identified in HT115 strain): 5'- GCCAGGCGAGGAGTGAGTGTG-3'/5'-AGCGGCGGGCCTTTGACC-3'. Reference: Chi C, et al. Genes Dev. 2016 Feb 1;30(3):307-20.

wgIs789 [tab-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs86 [peb-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

nsEx1086 [T02B11.3p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Specific expression of GFP in AMsh. Reference: Bacaj T, et al. Science. 2008 Oct 31;322(5902):744-7.

feEx43 [dab-1::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Holmes et al. J Cell Sci. 2007 Aug 1;120(Pt 15):2741-51.

Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous tab-1 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.

mCherry tag inserted into the endogenous ikb-1 locus. IKB-1::mCherry is observed in the pharynx and body wall muscles during development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

GFP tag inserted at the C-terminus of the endogenous nob-1 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030

SL2::GFP::H2B tags inserted at C-terminus of gbb-1 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.

syEx1341 [ges-1p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the intestine. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in the intestine. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1342 [myo-2p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + unc-122p::mCherry::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the pharynx. Maintain at 25C and pick animals with red fluorescence in coelomocytes. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in pharyngeal muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1343 [myo-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in body wall muscle. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in body wall muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1344 [rab-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed + pha-1(+) + pBluescript]. GFP expression in neurons. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in neurons. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434).

syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).

F11C7.4 Homozygous. Outer Left Sequence: TGAATCTTTGCAATTCGTGG. Outer Right Sequence: CTTGGTGTTCAACATGACCG. Inner Left Sequence: ATTGGCAAACGATTTTCTCG. Inner Right Sequence: CAGTCAACGGACAGCTTGAA. Inner Primer WT PCR Product: 3232. Deletion size: 843 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C43E11.6. Homozygous. Outer Left Sequence: ATCGCAATTTTCTCCATTCG. Outer Right Sequence: GCGTACTTCTTTCGGAGTGG. Inner Left Sequence: TATTCCGATTCCACACAGCA. Inner Right Sequence: CGATGCGTCAATTTATGTGG. Inner Primer WT PCR Product: 3254. Deletion size: 1032 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807