Search Strains

C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10C1.5 Homozygous. Outer Left Sequence: acacacccagaagaccatcc. Outer Right Sequence: tgagcattccttttgggaac. Inner Left Sequence: tgcttttcccgttcaaactt. Inner Right Sequence: cagaatgcctgtttctccgt. Inner Primer PCR Length: 2208. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49G7.1 Homozygous. Outer Left Sequence: cttatgggtttcaccacgct. Outer Right Sequence: cggctggaaaaagttaccaa. Inner Left Sequence: gcaaactcgaaagcagttcc. Inner Right Sequence: agtagcgggcaaaagactga. Inner Primer PCR Length: 2650. Deletion Size: 1045 bp. Deletion left flank: AAAAATGCAACGACCGACTTCAACGGCCACC. Deletion right flank: TTTGTACTGAACTTTCTTAACCAGGTACTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C41C4.5 Homozygous. Outer Left Sequence: gttatgacgaagagcgaggc. Outer Right Sequence: cgaagaccataattcgctcc. Inner Left Sequence: cgtttgagcacaccttcaaa. Inner Right Sequence: catctctccaactgcgaaca. Inner Primer PCR Length: 3052. Estimated Deletion Size: about 950 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y32G9 Homozygous. Outer Left Sequence: ttcacctctttcaattgccc. Outer Right Sequence: gaaaatcgaaattcggcaaa. Inner Left Sequence: ctaagtggtgccactgacga. Inner Right Sequence: tatatcgacccgagccaaac. Inner Primer PCR Length: 2659. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0228.5 Homozygous. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C13G3.3 Homozygous. Outer Left Sequence: gatgtgcaaagagtggggtt. Outer Right Sequence: ttggtttgttacgcctttcc. Inner Left Sequence: aaagtcgcatttggatttgc. Inner Right Sequence: tttccccaacttcacgaaac. Inner Primer PCR Length: 2336. Estimated Deletion Size: about 550 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03F1.2. Homozygous. Outer Left Sequence: ATGAAGTTGTCAAGGCCACC. Outer Right Sequence: CGTTTCAATGAGCCTGGAGT. Inner Left Sequence: ATTGGAGGAGGTGACACTGC. Inner Right Sequence: AGAGTTGAAGAGAATGCGGC. Inner Primer PCR Length: 2182 bp. Deletion Size: 1210 bp. Deletion left flank: AACACACGACTTCACCCACATCGCATTGGA. Deletion right flank: TTTAGCACGTGTCTCAGCTTCTGCCGCATT. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M195.2 Homozygous. Outer Left Sequence: acgaggtatctgccaacgac. Outer Right Sequence: ctccaagagccttatcaccg. Inner Left Sequence: tagactgatgcgaaatcccc. Inner Right Sequence: gtttctggcttcaatttcgg. Inner Primer PCR Length: 2246. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T04C9.1a Homozygous. Outer Left Sequence: tcttcgcttgtccatatccc. Outer Right Sequence: gcgttttgcaaacaaaaaca. Inner Left Sequence: gactctgcgctcatcacaaa. Inner Right Sequence: ggtctccgtgagcatgattt. Inner Primer PCR Length: 3187. Estimated Deletion Size: about 2150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73E7A.4 Homozygous. Outer Left Sequence: ctcaatagagcgcgatttcc. Outer Right Sequence: gaggggcacggttaattttt. Inner Left Sequence: tcgccatagttttcgctttt. Inner Right Sequence: tttttgatgggtgggaatgt. Inner Primer PCR Length: 2695. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33A8.2 Homozygous. Outer Left Sequence: agtggaatcggatgatcgac. Outer Right Sequence: cccaacaatccatgatttcc. Inner Left Sequence: gcaaagaaattaggcgaacg. Inner Right Sequence: aaagctcacggagccaagta. Inner Primer PCR Length: 2326. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47G4.3 Homozygous. Outer Left Sequence: cccagttgttttggctgaat. Outer Right Sequence: acgttcggttcctgtttcac. Inner Left Sequence: ccctcttcaggattcttccc. Inner Right Sequence: tccgctagatccatttccag. Inner Primer PCR Length: 2578. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C47E8.8 Homozygous. Outer Left Sequence: cgtctggcaaaacttttcgt. Outer Right Sequence: atcattcgctcgagttctgg. Inner Left Sequence: aaaatcattccgatgatgcc. Inner Right Sequence: tcagcttcttcctggtcgat. Inner Primer PCR Length: 3215. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1321.2 Homozygous. Outer Left Sequence: aactgctcccacatccattc. Outer Right Sequence: ccggaattccaaatcagaga. Inner Left Sequence: aaatgttgcctgtctccacc. Inner Right Sequence: ggggagaatcgatgacaaga. Inner Primer PCR Length: 3202. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y58G8A.4 Homozygous. Outer Left Sequence: ccgggtttgctgtaggatta. Outer Right Sequence: atgaccgagagatgtctgcc. Inner Left Sequence: cagtccggaacgtttttgtt. Inner Right Sequence: ccctctcctcccctacactc. Inner Primer PCR Length: 2613. Deletion Size: about 784 bp. Sequence across the breakpoint: AGTTGGAGCCTCACTGCAAT-breakpoint-GTCTTTCGAGCACGTCGATGGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.7 Homozygous. Outer Left Sequence: atcggaagctgcaaactgat. Outer Right Sequence: ccttcgatttttccgattca. Inner Left Sequence: tacatgtcgtgcatggttcc. Inner Right Sequence: cgccagaatatccttttcca. Inner Primer PCR Length: 1915. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1251.8 Homozygous. Outer Left Sequence: aagtgcagcttccacattcc. Outer Right Sequence: atacaacaggcggtgtaggc. Inner Left Sequence: ctgacggctttgctcttttc. Inner Right Sequence: attgttgagccgattggaac. Inner Primer PCR Length: 3116. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09H5.2. Homozygous. Outer Left Sequence: GCGTCGAGAAGTGATGTCAA. Outer Right Sequence: GCCATTCCGTGAACAAAGAT. Inner Left Sequence: TGCACATTGCTCAACTCTCC. Inner Right Sequence: AAGACTTGTTGCTCGGCATT. Inner Primer PCR Length: 3115 bp. Deletion Size: 1027 bp. Deletion left flank: GACGCTCCACTTAAAGATATTTTAAGTGTG. Deletion right flank: TTGCTATGGGTCTTGCCGGAAGTGATGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03A11. Homozygous. Outer Left Sequence: ACAACGCCAAATTCGGTTAG. Outer Right Sequence: TGGTCTAGAGCAAATGCGTG. Inner Left Sequence: TCTATGCTTTGCAAATCCCC. Inner Right Sequence: TCATGTGCTCTACGCGTTTC. Inner Primer PCR Length: 2374 bp. Deletion Size: 773 bp. Deletion left flank: TCTTCTATGCTTGTCCTTGCGACGCTTCTC. Deletion right flank: GTGGACATTGGGAACAAAGCTTCAGTATTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W02B12.8, W02B12.7. Homozygous. Outer Left Sequence: CCGGTTTCCAGATTCAAAAA. Outer Right Sequence: AAGAGCGAGAAGTGGCCATA. Inner Left Sequence: AGTGCATCCAACACGATTCA. Inner Right Sequence: AATGCAAAAGCTGAACACCC. Inner Primer PCR Length: 2898 bp. Deletion Size: 1008 bp. Deletion left flank: AACTCCGGATTGGGCGGTCGGAGGAAAGAA. Deletion right flank: AGAATTAATAAAGGTATTTAATAGGCTAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02G10.3. Homozygous. Outer Left Sequence: TCGTGTGCTTGTTCACATCA. Outer Right Sequence: AGGTTCAACAACAGCGTTCC. Inner Left Sequence: CGCTCTTTCAAAACTGGCTC. Inner Right Sequence: CGTCGTGATTGCGTAAAGAA. Inner Primer PCR Length: 3123 bp. Deletion Size: 1139 bp. Deletion left flank: ACAAAATGTCATTATTATGAATAAATTGCC. Deletion right flank: AGAATTATCCAAATCGGTCAACTTCTCTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71G12B.11 Homozygous. Outer Left Sequence: tgaagtggtggctcttgttg. Outer Right Sequence: aagttccgtttgttggttgc. Inner Left Sequence: tggtttctaaggggttgcag. Inner Right Sequence: gcgcttctctcaatttgtcc. Inner Primer PCR Length: 3151. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T14G8.1. Homozygous. Outer Left Sequence: TCTCGGATAGGACGAACCAG. Outer Right Sequence: GGGCTGCACTAGTCGTTGAT. Inner Left Sequence: GTTCATCATCAGGCGACAAA. Inner Right Sequence: TACCGTGTGCTTCTCACTGG. Inner Primer PCR Length: 3222 bp. Deletion Size: 1081 bp. Deletion left flank: AGTACGCCTTGAACACTTTTTCCGATTTGT. Deletion right flank: AACTGATGTGATTCTTTCTTCAACTGATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47H9C.6. Homozygous. Outer Left Sequence: GGAATCGGAATTGGAACTCA. Outer Right Sequence: CTTCATCGCCACTCACTCAA. Inner Left Sequence: TAATTTCAGCCAATTTGCCC. Inner Right Sequence: CAAACGCCACTGGATTCTCT. Inner Primer PCR Length: 2153 bp. Deletion Size: 1249 bp. Deletion left flank: TCTTTTGAGAGAGCCAATAAGTTTTATTTT. Deletion right flank: TCCGCTTGCGACGACGAGGTTTGGTGTGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56G4.5 Homozygous. Outer Left Sequence: atcatgcctaggtttggacg. Outer Right Sequence: attaagagcggcaagcagaa. Inner Left Sequence: aaaaatttctgggtcccacc. Inner Right Sequence: gaaacaattggcccattcac. Inner Primer PCR Length: 3230. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04G2.7 Homozygous. Outer Left Sequence: ttatggtcgagccgtttacc. Outer Right Sequence: tgcgatagcaatggacagag. Inner Left Sequence: ctccgtcccattccagtaaa. Inner Right Sequence: gaatggatgaggcgtgagat. Inner Primer PCR Length: 2190. Deletion size: 1825 bp. Left flank: ATGTTTAGATTATCCTATTGGTAAATATAT. Right flank: AGAAGATGTAGAAGTCCTCACCGGATTCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R06F6.2 Homozygous. Outer Left Sequence: gtcatgggcctcgttaggta. Outer Right Sequence: ccacaaattccatttttgcc. Inner Left Sequence: caaatttacgactttgccgc. Inner Right Sequence: gattcaaattcccgcaaaaa. Inner Primer PCR Length: 3189. Deletion size: 1927 bp. Left flank: CGTCCTCATTCTTTTTATTAATAAATCGAT. Right flank: TGTCCAGTACTTTCATCAAAAGTCCAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C23H3.4. Homozygous. Outer Left Sequence: CCAAATTCCCCACTTACCCT. Outer Right Sequence: CTGAAATTTTGCCACGGATT. Inner Left Sequence: AGCCCAAGCCAATTATCCTT. Inner Right Sequence: AACACGAACTTTGAATCGCC. Inner Primer PCR Length: 3320 bp. Deletion Size: 963 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05F1.1 Homozygous. Outer Left Sequence: cttcaagagtggccatttcc. Outer Right Sequence: cttcaagagtggccatttcc. Inner Left Sequence: tttaatgcgggaaagtgacc. Inner Right Sequence: catgcgtgtgcctttaactg. Inner Primer PCR Length: 2592. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK355.3. Homozygous. Outer Left Sequence: GTCTGGGCGATCCTGTATGT. Outer Right Sequence: GTAGGCGTAGGCGAGATGAG. Inner Left Sequence: AAGACCAAGCTGAGATCGGA. Inner Right Sequence: CTTTTCTCCTGGACTGCACC. Inner Primer PCR Length: 2231 bp. Deletion Size: 1814 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30B5.3 Homozygous. Outer Left Sequence: aacagcaaaatgccaaatcc. Outer Right Sequence: aaaacgtctccgaacaccac. Inner Left Sequence: ggaattccagcactccattg. Inner Right Sequence: agatttcggtcgcttcaaga. Inner Primer PCR Length: 2117. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07E3.1. Homozygous. Outer Left Sequence: AGATGTGGCGTGTAGGAACC. Outer Right Sequence: AAGTCCCCGCTCTTTGATTT. Inner Left Sequence: AGCTGAAACCCCAGTTGAGA. Inner Right Sequence: GCTTCGTCTCTTCATGACCC. Inner Primer PCR Length: 2102 bp. Deletion Size: 927 bp. Deletion left flank: AATTCACTAGCCAGTTAATGATAGAATCCT. Deletion right flank: AAAAGTACCAAGTGTCTTTTCTGTCTGTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F30H5.3. Homozygous. Outer Left Sequence: ccgttgcgaacaaaaagaat. Outer Right Sequence: gttacccgtgcctgtgagat. Inner Left Sequence: tacttgtcacgacagacgcc. Inner Right Sequence: ccagaacacttgcgagaaca. Inner Primer PCR Length: 2995. Deletion Size: 1766. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15E6.6. Homozygous. Outer Left Sequence: tcctctcacaacatgccaaa. Outer Right Sequence: tcagtagcaacccgtaaccc. Inner Left Sequence: agtgctgcagtcaacaatgg. Inner Right Sequence: aaaatccagaaaccgtggtg. Inner Primer PCR Length: 3224. Deletion Size: 950. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25C8.2. Homozygous. Outer Left Sequence: GCACCAACGGTTGTTTGATA. Outer Right Sequence: TCCAGACGTTTCCAGATTCC. Inner Left Sequence: TCCCCAGCAAAGCAAATAAC. Inner Right Sequence: AAATAATGCAAACGCGCTCT. Inner Primer PCR Length: 3228 bp. Deletion Size: 1581 bp. Deletion left flank: CCTTATTGTAATTTTTGCAAAATCCTTAAA. Deletion right flank: TGCAAAAGTTTGTCAGACAGTTTCTTAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44G4.8 Homozygous. Outer Left Sequence: ctccatgaattgaggggttg. Outer Right Sequence: aatttcgacaatgacgctcc. Inner Left Sequence: ggagtcacggaagagatgga. Inner Right Sequence: tcgaacaaagaaagcgaggt. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38C9A.2 Homozygous. Outer Left Sequence: gtctgacgaaccgatccaat. Outer Right Sequence: tgaccagtttcgctattccc. Inner Left Sequence: tcgccttgtatcagttgcag. Inner Right Sequence: tttgtgtctgcgtcctcttg. Inner Primer PCR Length: 2721. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11A5.4. Homozygous. Outer Left Sequence: TGCTATGGAAGCGACTGTTG. Outer Right Sequence: TGCTTGCTTCATTTTTCACG. Inner Left Sequence: TTATCCCTTTTCCCCATTCC. Inner Right Sequence: ATACCTGCCATTGGACTTCG. Inner Primer PCR Length: 2332 bp. Deletion Size: 658 bp. Deletion left flank: CACGAGATTTATAGAAAGCTTAACTTTGGA. Deletion right flank: TATGCGCATGGTGGTCTTTGCCGAGTTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13G4.3. Homozygous. Outer Left Sequence: TCCGTAAAAAGCACTGACCC. Outer Right Sequence: TTCTTTCCACCAGCCAATTC. Inner Left Sequence: AAAATCCCAAGTGCAAGACG. Inner Right Sequence: CTTCCCGGAGACCTCTTACC. Inner Primer PCR Length: 3029 bp. Deletion Size: 2025 bp. Deletion left flank: AATGGAAAATTATCATCCGAGAACCGCGTT. Deletion right flank: CAGAGACCATTCAAATGTCTGAAGCAGCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58E6.1. Homozygous. [NOTE (N. Pujol - 12/02/13): This strain reportedly contains an unidentified lethal mutation in the background. See IG1241 for a strain that has been outcrossed to remove this background mutation.] Outer Left Sequence: GCAAAACGAGTTTCTCGACC. Outer Right Sequence: TTGTGATTCCTGACCCCTTC. Inner Left Sequence: CTCTTCTGCATTCTCCCCAG. Inner Right Sequence: GCCAAATGATGTCTCCGATT. Inner Primer PCR Length: 3148 bp. Deletion Size: 864 bp. Deletion left flank: ATTGTTAAATGTGGTGAAGCAGAGAATCAT. Deletion right flank: GAAATGAAATTTCAAGCAATCATAGAAACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49H6.5. Homozygous. Outer Left Sequence: TTGCTCGTTGCCATAAAGTG. Outer Right Sequence: TCGTCGCTGGAGAAGAGATT. Inner Left Sequence: CAGGAGTGTGCCAAGACTCA. Inner Right Sequence: GCAAGTTTTTCAGAGCGTCC. Inner Primer PCR Length: 2165 bp. Deletion Size: 761 bp. Deletion left flank: TATTGAACAGACGTTATCATTATTCGTCAT. Deletion right flank: TCGGAATGATCTTGTGCAGATTGTTGGTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G5.2. Homozygous. Outer Left Sequence: AACGGATTTCGCATCGTAGT. Outer Right Sequence: GCCTGCGGTAAGAAACAGAG. Inner Left Sequence: ATTTTTGAAAGCAGCAACGC. Inner Right Sequence: TCAAATTCTTTGGAATCGCC. Inner Primer PCR Length: 3004 bp. Deletion Size: 860 bp. Deletion left flank: CATGATGGTTTTCATTGTCGTGTGTGGAGT. Deletion right flank: TTGAAACAAAAATGAGCAAGTATTAGAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G5.15. Homozygous. Outer Left Sequence: AACGGATTTCGCATCGTAGT. Outer Right Sequence: GCCTGCGGTAAGAAACAGAG. Inner Left Sequence: ATTTTTGAAAGCAGCAACGC. Inner Right Sequence: TCAAATTCTTTGGAATCGCC. Inner Primer PCR Length: 3004 bp. Deletion Size: 1240 bp. Deletion left flank: AGGTTAATTATTTTCCGAAAACTCTGTAAC. Deletion right flank: CTACAAATCATCTTTTTATCGTCAAAAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E01A2.7. Homozygous. Outer Left Sequence: CAACGATCCAACTCCATTCC. Outer Right Sequence: GGTTGTAAATGCTCTCGGCT. Inner Left Sequence: ACTCAGTTTGGGTGCGAAAG. Inner Right Sequence: TTGTTGGGTGTTTCCATTCA. Inner Primer PCR Length: 2347 bp. Deletion Size: 1265 bp. Deletion left flank: CATTCATTGTGATATTTTTAAGTGAACCGT. Deletion right flank: ATTGTTCAAAATCCAATGAGACAATCCGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11G12.2. Homozygous. Outer Left Sequence: GGGTCCGTCCTTTAGACCAT. Outer Right Sequence: TGTTGTTGCTGGAGCAATTC. Inner Left Sequence: CCCTGCATATGTGTGAAACG. Inner Right Sequence: CGCTTTTCCAGTTTTTGACC. Inner Primer PCR Length: 3281 bp. Deletion Size: 2857 bp. Deletion left flank: AAAGAAGTGAAGCGGCTCTACCACCCCGAC. Deletion right flank: AGAAATCATGTTTGGAAAACAAAAATATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01C3. Homozygous. Outer Left Sequence: CCTGGCTGTTACCCAAGTGT. Outer Right Sequence: GCTCACATGAAGTGCAGCAT. Inner Left Sequence: CGAGAAGGGAAATTCCACAA. Inner Right Sequence: TGTGTAGGCTCCCTAATGCC. Inner Primer PCR Length: 2419 bp. Deletion Size: 762 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807