Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB1284 C. elegans C30F12.6(ok1381) I. Show Description
C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1295 C. elegans F10C1.5(ok1394) II. Show Description
F10C1.5 Homozygous. Outer Left Sequence: acacacccagaagaccatcc. Outer Right Sequence: tgagcattccttttgggaac. Inner Left Sequence: tgcttttcccgttcaaactt. Inner Right Sequence: cagaatgcctgtttctccgt. Inner Primer PCR Length: 2208. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1298 C. elegans C25E10.11(ok1405) V. Show Description
C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1315 C. elegans C49G7.1(ok1431) V. Show Description
C49G7.1 Homozygous. Outer Left Sequence: cttatgggtttcaccacgct. Outer Right Sequence: cggctggaaaaagttaccaa. Inner Left Sequence: gcaaactcgaaagcagttcc. Inner Right Sequence: agtagcgggcaaaagactga. Inner Primer PCR Length: 2650. Deletion Size: 1045 bp. Deletion left flank: AAAAATGCAACGACCGACTTCAACGGCCACC. Deletion right flank: TTTGTACTGAACTTTCTTAACCAGGTACTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1316 C. elegans unc-105(ok1432) II. Show Description
C41C4.5 Homozygous. Outer Left Sequence: gttatgacgaagagcgaggc. Outer Right Sequence: cgaagaccataattcgctcc. Inner Left Sequence: cgtttgagcacaccttcaaa. Inner Right Sequence: catctctccaactgcgaaca. Inner Primer PCR Length: 3052. Estimated Deletion Size: about 950 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1317 C. elegans srp-3(ok1433) V. Show Description
Y32G9 Homozygous. Outer Left Sequence: ttcacctctttcaattgccc. Outer Right Sequence: gaaaatcgaaattcggcaaa. Inner Left Sequence: ctaagtggtgccactgacga. Inner Right Sequence: tatatcgacccgagccaaac. Inner Primer PCR Length: 2659. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1332 C. elegans trx-1(ok1449) II. Show Description
B0228.5 Homozygous. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1338 C. elegans C13G3.3(ok1467) V. Show Description
C13G3.3 Homozygous. Outer Left Sequence: gatgtgcaaagagtggggtt. Outer Right Sequence: ttggtttgttacgcctttcc. Inner Left Sequence: aaagtcgcatttggatttgc. Inner Right Sequence: tttccccaacttcacgaaac. Inner Primer PCR Length: 2336. Estimated Deletion Size: about 550 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1345 C. elegans coq-4(ok1490) I. Show Description
T03F1.2. Homozygous. Outer Left Sequence: ATGAAGTTGTCAAGGCCACC. Outer Right Sequence: CGTTTCAATGAGCCTGGAGT. Inner Left Sequence: ATTGGAGGAGGTGACACTGC. Inner Right Sequence: AGAGTTGAAGAGAATGCGGC. Inner Primer PCR Length: 2182 bp. Deletion Size: 1210 bp. Deletion left flank: AACACACGACTTCACCCACATCGCATTGGA. Deletion right flank: TTTAGCACGTGTCTCAGCTTCTGCCGCATT. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1348 C. elegans M195.2(ok1503) II. Show Description
M195.2 Homozygous. Outer Left Sequence: acgaggtatctgccaacgac. Outer Right Sequence: ctccaagagccttatcaccg. Inner Left Sequence: tagactgatgcgaaatcccc. Inner Right Sequence: gtttctggcttcaatttcgg. Inner Primer PCR Length: 2246. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1355 C. elegans T04C9.1a(ok1510) III. Show Description
T04C9.1a Homozygous. Outer Left Sequence: tcttcgcttgtccatatccc. Outer Right Sequence: gcgttttgcaaacaaaaaca. Inner Left Sequence: gactctgcgctcatcacaaa. Inner Right Sequence: ggtctccgtgagcatgattt. Inner Primer PCR Length: 3187. Estimated Deletion Size: about 2150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1367 C. elegans Y73E7A.4(ok1552) I. Show Description
Y73E7A.4 Homozygous. Outer Left Sequence: ctcaatagagcgcgatttcc. Outer Right Sequence: gaggggcacggttaattttt. Inner Left Sequence: tcgccatagttttcgctttt. Inner Right Sequence: tttttgatgggtgggaatgt. Inner Primer PCR Length: 2695. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1372 C. elegans nlp-18(ok1557) II. Show Description
F33A8.2 Homozygous. Outer Left Sequence: agtggaatcggatgatcgac. Outer Right Sequence: cccaacaatccatgatttcc. Inner Left Sequence: gcaaagaaattaggcgaacg. Inner Right Sequence: aaagctcacggagccaagta. Inner Primer PCR Length: 2326. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1373 C. elegans F47G4.3(ok1558) I. Show Description
F47G4.3 Homozygous. Outer Left Sequence: cccagttgttttggctgaat. Outer Right Sequence: acgttcggttcctgtttcac. Inner Left Sequence: ccctcttcaggattcttccc. Inner Right Sequence: tccgctagatccatttccag. Inner Primer PCR Length: 2578. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1383 C. elegans C47E8.8(ok1568) V. Show Description
C47E8.8 Homozygous. Outer Left Sequence: cgtctggcaaaacttttcgt. Outer Right Sequence: atcattcgctcgagttctgg. Inner Left Sequence: aaaatcattccgatgatgcc. Inner Right Sequence: tcagcttcttcctggtcgat. Inner Primer PCR Length: 3215. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1392 C. elegans ZK1321.2(ok1581) II. Show Description
ZK1321.2 Homozygous. Outer Left Sequence: aactgctcccacatccattc. Outer Right Sequence: ccggaattccaaatcagaga. Inner Left Sequence: aaatgttgcctgtctccacc. Inner Right Sequence: ggggagaatcgatgacaaga. Inner Primer PCR Length: 3202. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1393 C. elegans npr-5(ok1583) V. Show Description
Y58G8A.4 Homozygous. Outer Left Sequence: ccgggtttgctgtaggatta. Outer Right Sequence: atgaccgagagatgtctgcc. Inner Left Sequence: cagtccggaacgtttttgtt. Inner Right Sequence: ccctctcctcccctacactc. Inner Primer PCR Length: 2613. Deletion Size: about 784 bp. Sequence across the breakpoint: AGTTGGAGCCTCACTGCAAT-breakpoint-GTCTTTCGAGCACGTCGATGGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1397 C. elegans F23B2.7(ok261) IV. Show Description
F23B2.7 Homozygous. Outer Left Sequence: atcggaagctgcaaactgat. Outer Right Sequence: ccttcgatttttccgattca. Inner Left Sequence: tacatgtcgtgcatggttcc. Inner Right Sequence: cgccagaatatccttttcca. Inner Primer PCR Length: 1915. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1414 C. elegans twk-9(ok1611) IV. Show Description
ZK1251.8 Homozygous. Outer Left Sequence: aagtgcagcttccacattcc. Outer Right Sequence: atacaacaggcggtgtaggc. Inner Left Sequence: ctgacggctttgctcttttc. Inner Right Sequence: attgttgagccgattggaac. Inner Primer PCR Length: 3116. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1415 C. elegans C09H5.2(ok1612) V. Show Description
C09H5.2. Homozygous. Outer Left Sequence: GCGTCGAGAAGTGATGTCAA. Outer Right Sequence: GCCATTCCGTGAACAAAGAT. Inner Left Sequence: TGCACATTGCTCAACTCTCC. Inner Right Sequence: AAGACTTGTTGCTCGGCATT. Inner Primer PCR Length: 3115 bp. Deletion Size: 1027 bp. Deletion left flank: GACGCTCCACTTAAAGATATTTTAAGTGTG. Deletion right flank: TTGCTATGGGTCTTGCCGGAAGTGATGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1422 C. elegans cpx-2(ok1619) X. Show Description
K03A11. Homozygous. Outer Left Sequence: ACAACGCCAAATTCGGTTAG. Outer Right Sequence: TGGTCTAGAGCAAATGCGTG. Inner Left Sequence: TCTATGCTTTGCAAATCCCC. Inner Right Sequence: TCATGTGCTCTACGCGTTTC. Inner Primer PCR Length: 2374 bp. Deletion Size: 773 bp. Deletion left flank: TCTTCTATGCTTGTCCTTGCGACGCTTCTC. Deletion right flank: GTGGACATTGGGAACAAAGCTTCAGTATTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1430 C. elegans klp-17&rga-1(ok1630) II. Show Description
W02B12.8, W02B12.7. Homozygous. Outer Left Sequence: CCGGTTTCCAGATTCAAAAA. Outer Right Sequence: AAGAGCGAGAAGTGGCCATA. Inner Left Sequence: AGTGCATCCAACACGATTCA. Inner Right Sequence: AATGCAAAAGCTGAACACCC. Inner Primer PCR Length: 2898 bp. Deletion Size: 1008 bp. Deletion left flank: AACTCCGGATTGGGCGGTCGGAGGAAAGAA. Deletion right flank: AGAATTAATAAAGGTATTTAATAGGCTAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1443 C. elegans K02G10.3(ok1646) X. Show Description
K02G10.3. Homozygous. Outer Left Sequence: TCGTGTGCTTGTTCACATCA. Outer Right Sequence: AGGTTCAACAACAGCGTTCC. Inner Left Sequence: CGCTCTTTCAAAACTGGCTC. Inner Right Sequence: CGTCGTGATTGCGTAAAGAA. Inner Primer PCR Length: 3123 bp. Deletion Size: 1139 bp. Deletion left flank: ACAAAATGTCATTATTATGAATAAATTGCC. Deletion right flank: AGAATTATCCAAATCGGTCAACTTCTCTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1445 C. elegans Y71G12B.11(ok1648) I. Show Description
Y71G12B.11 Homozygous. Outer Left Sequence: tgaagtggtggctcttgttg. Outer Right Sequence: aagttccgtttgttggttgc. Inner Left Sequence: tggtttctaaggggttgcag. Inner Right Sequence: gcgcttctctcaatttgtcc. Inner Primer PCR Length: 3151. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1447 C. elegans chd-3(ok1651) X. Show Description
T14G8.1. Homozygous. Outer Left Sequence: TCTCGGATAGGACGAACCAG. Outer Right Sequence: GGGCTGCACTAGTCGTTGAT. Inner Left Sequence: GTTCATCATCAGGCGACAAA. Inner Right Sequence: TACCGTGTGCTTCTCACTGG. Inner Primer PCR Length: 3222 bp. Deletion Size: 1081 bp. Deletion left flank: AGTACGCCTTGAACACTTTTTCCGATTTGT. Deletion right flank: AACTGATGTGATTCTTTCTTCAACTGATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1450 C. elegans csp-3(ok1653) I. Show Description
Y47H9C.6. Homozygous. Outer Left Sequence: GGAATCGGAATTGGAACTCA. Outer Right Sequence: CTTCATCGCCACTCACTCAA. Inner Left Sequence: TAATTTCAGCCAATTTGCCC. Inner Right Sequence: CAAACGCCACTGGATTCTCT. Inner Primer PCR Length: 2153 bp. Deletion Size: 1249 bp. Deletion left flank: TCTTTTGAGAGAGCCAATAAGTTTTATTTT. Deletion right flank: TCCGCTTGCGACGACGAGGTTTGGTGTGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1452 C. elegans F56G4.5(ok1654) I. Show Description
F56G4.5 Homozygous. Outer Left Sequence: atcatgcctaggtttggacg. Outer Right Sequence: attaagagcggcaagcagaa. Inner Left Sequence: aaaaatttctgggtcccacc. Inner Right Sequence: gaaacaattggcccattcac. Inner Primer PCR Length: 3230. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1454 C. elegans K04G2.7(ok1661) I. Show Description
K04G2.7 Homozygous. Outer Left Sequence: ttatggtcgagccgtttacc. Outer Right Sequence: tgcgatagcaatggacagag. Inner Left Sequence: ctccgtcccattccagtaaa. Inner Right Sequence: gaatggatgaggcgtgagat. Inner Primer PCR Length: 2190. Deletion size: 1825 bp. Left flank: ATGTTTAGATTATCCTATTGGTAAATATAT. Right flank: AGAAGATGTAGAAGTCCTCACCGGATTCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1457 C. elegans R06F6.2(ok1664) II. Show Description
R06F6.2 Homozygous. Outer Left Sequence: gtcatgggcctcgttaggta. Outer Right Sequence: ccacaaattccatttttgcc. Inner Left Sequence: caaatttacgactttgccgc. Inner Right Sequence: gattcaaattcccgcaaaaa. Inner Primer PCR Length: 3189. Deletion size: 1927 bp. Left flank: CGTCCTCATTCTTTTTATTAATAAATCGAT. Right flank: TGTCCAGTACTTTCATCAAAAGTCCAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1465 C. elegans C23H3.4(ok1693) II. Show Description
C23H3.4. Homozygous. Outer Left Sequence: CCAAATTCCCCACTTACCCT. Outer Right Sequence: CTGAAATTTTGCCACGGATT. Inner Left Sequence: AGCCCAAGCCAATTATCCTT. Inner Right Sequence: AACACGAACTTTGAATCGCC. Inner Primer PCR Length: 3320 bp. Deletion Size: 963 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1478 C. elegans F13B12.3(ok1729) IV. Show Description
F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1479 C. elegans F13B12.3(ok1730) IV. Show Description
F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1480 C. elegans T05F1.1(ok1731) I. Show Description
T05F1.1 Homozygous. Outer Left Sequence: cttcaagagtggccatttcc. Outer Right Sequence: cttcaagagtggccatttcc. Inner Left Sequence: tttaatgcgggaaagtgacc. Inner Right Sequence: catgcgtgtgcctttaactg. Inner Primer PCR Length: 2592. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1495 C. elegans ZK355.3(ok1760) II. Show Description
ZK355.3. Homozygous. Outer Left Sequence: GTCTGGGCGATCCTGTATGT. Outer Right Sequence: GTAGGCGTAGGCGAGATGAG. Inner Left Sequence: AAGACCAAGCTGAGATCGGA. Inner Right Sequence: CTTTTCTCCTGGACTGCACC. Inner Primer PCR Length: 2231 bp. Deletion Size: 1814 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1503 C. elegans cpb-2(ok1772) II. Show Description
C30B5.3 Homozygous. Outer Left Sequence: aacagcaaaatgccaaatcc. Outer Right Sequence: aaaacgtctccgaacaccac. Inner Left Sequence: ggaattccagcactccattg. Inner Right Sequence: agatttcggtcgcttcaaga. Inner Primer PCR Length: 2117. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1506 C. elegans R07E3.1(ok1776) X. Show Description
R07E3.1. Homozygous. Outer Left Sequence: AGATGTGGCGTGTAGGAACC. Outer Right Sequence: AAGTCCCCGCTCTTTGATTT. Inner Left Sequence: AGCTGAAACCCCAGTTGAGA. Inner Right Sequence: GCTTCGTCTCTTCATGACCC. Inner Primer PCR Length: 2102 bp. Deletion Size: 927 bp. Deletion left flank: AATTCACTAGCCAGTTAATGATAGAATCCT. Deletion right flank: AAAAGTACCAAGTGTCTTTTCTGTCTGTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1518 C. elegans F30H5.3(ok1814) III. Show Description
F30H5.3. Homozygous. Outer Left Sequence: ccgttgcgaacaaaaagaat. Outer Right Sequence: gttacccgtgcctgtgagat. Inner Left Sequence: tacttgtcacgacagacgcc. Inner Right Sequence: ccagaacacttgcgagaaca. Inner Primer PCR Length: 2995. Deletion Size: 1766. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1520 C. elegans F15E6.6(ok1816) IV. Show Description
F15E6.6. Homozygous. Outer Left Sequence: tcctctcacaacatgccaaa. Outer Right Sequence: tcagtagcaacccgtaaccc. Inner Left Sequence: agtgctgcagtcaacaatgg. Inner Right Sequence: aaaatccagaaaccgtggtg. Inner Primer PCR Length: 3224. Deletion Size: 950. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1533 C. elegans amx-3(ok1838) V. Show Description
F25C8.2. Homozygous. Outer Left Sequence: GCACCAACGGTTGTTTGATA. Outer Right Sequence: TCCAGACGTTTCCAGATTCC. Inner Left Sequence: TCCCCAGCAAAGCAAATAAC. Inner Right Sequence: AAATAATGCAAACGCGCTCT. Inner Primer PCR Length: 3228 bp. Deletion Size: 1581 bp. Deletion left flank: CCTTATTGTAATTTTTGCAAAATCCTTAAA. Deletion right flank: TGCAAAAGTTTGTCAGACAGTTTCTTAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1536 C. elegans dep-1(ok1844) II. Show Description
F44G4.8 Homozygous. Outer Left Sequence: ctccatgaattgaggggttg. Outer Right Sequence: aatttcgacaatgacgctcc. Inner Left Sequence: ggagtcacggaagagatgga. Inner Right Sequence: tcgaacaaagaaagcgaggt. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1538 C. elegans cgp-1(ok1846) V. Show Description
Y38C9A.2 Homozygous. Outer Left Sequence: gtctgacgaaccgatccaat. Outer Right Sequence: tgaccagtttcgctattccc. Inner Left Sequence: tcgccttgtatcagttgcag. Inner Right Sequence: tttgtgtctgcgtcctcttg. Inner Primer PCR Length: 2721. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1544 C. elegans F11A5.4(ok1857) V. Show Description
F11A5.4. Homozygous. Outer Left Sequence: TGCTATGGAAGCGACTGTTG. Outer Right Sequence: TGCTTGCTTCATTTTTCACG. Inner Left Sequence: TTATCCCTTTTCCCCATTCC. Inner Right Sequence: ATACCTGCCATTGGACTTCG. Inner Primer PCR Length: 2332 bp. Deletion Size: 658 bp. Deletion left flank: CACGAGATTTATAGAAAGCTTAACTTTGGA. Deletion right flank: TATGCGCATGGTGGTCTTTGCCGAGTTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1546 C. elegans T13G4.3(ok1859) X. Show Description
T13G4.3. Homozygous. Outer Left Sequence: TCCGTAAAAAGCACTGACCC. Outer Right Sequence: TTCTTTCCACCAGCCAATTC. Inner Left Sequence: AAAATCCCAAGTGCAAGACG. Inner Right Sequence: CTTCCCGGAGACCTCTTACC. Inner Primer PCR Length: 3029 bp. Deletion Size: 2025 bp. Deletion left flank: AATGGAAAATTATCATCCGAGAACCGCGTT. Deletion right flank: CAGAGACCATTCAAATGTCTGAAGCAGCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1547 C. elegans sta-2(ok1860) V. Show Description
F58E6.1. Homozygous. [NOTE (N. Pujol - 12/02/13): This strain reportedly contains an unidentified lethal mutation in the background. See IG1241 for a strain that has been outcrossed to remove this background mutation.] Outer Left Sequence: GCAAAACGAGTTTCTCGACC. Outer Right Sequence: TTGTGATTCCTGACCCCTTC. Inner Left Sequence: CTCTTCTGCATTCTCCCCAG. Inner Right Sequence: GCCAAATGATGTCTCCGATT. Inner Primer PCR Length: 3148 bp. Deletion Size: 864 bp. Deletion left flank: ATTGTTAAATGTGGTGAAGCAGAGAATCAT. Deletion right flank: GAAATGAAATTTCAAGCAATCATAGAAACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1551 C. elegans F49H6.5(ok1864) V. Show Description
F49H6.5. Homozygous. Outer Left Sequence: TTGCTCGTTGCCATAAAGTG. Outer Right Sequence: TCGTCGCTGGAGAAGAGATT. Inner Left Sequence: CAGGAGTGTGCCAAGACTCA. Inner Right Sequence: GCAAGTTTTTCAGAGCGTCC. Inner Primer PCR Length: 2165 bp. Deletion Size: 761 bp. Deletion left flank: TATTGAACAGACGTTATCATTATTCGTCAT. Deletion right flank: TCGGAATGATCTTGTGCAGATTGTTGGTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1552 C. elegans T08G5.15&T08G5.16(ok1870) V. Show Description
T08G5.2. Homozygous. Outer Left Sequence: AACGGATTTCGCATCGTAGT. Outer Right Sequence: GCCTGCGGTAAGAAACAGAG. Inner Left Sequence: ATTTTTGAAAGCAGCAACGC. Inner Right Sequence: TCAAATTCTTTGGAATCGCC. Inner Primer PCR Length: 3004 bp. Deletion Size: 860 bp. Deletion left flank: CATGATGGTTTTCATTGTCGTGTGTGGAGT. Deletion right flank: TTGAAACAAAAATGAGCAAGTATTAGAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1555 C. elegans T08G5.15(ok1883) V. Show Description
T08G5.15. Homozygous. Outer Left Sequence: AACGGATTTCGCATCGTAGT. Outer Right Sequence: GCCTGCGGTAAGAAACAGAG. Inner Left Sequence: ATTTTTGAAAGCAGCAACGC. Inner Right Sequence: TCAAATTCTTTGGAATCGCC. Inner Primer PCR Length: 3004 bp. Deletion Size: 1240 bp. Deletion left flank: AGGTTAATTATTTTCCGAAAACTCTGTAAC. Deletion right flank: CTACAAATCATCTTTTTATCGTCAAAAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1558 C. elegans E01A2.7(ok1886) I. Show Description
E01A2.7. Homozygous. Outer Left Sequence: CAACGATCCAACTCCATTCC. Outer Right Sequence: GGTTGTAAATGCTCTCGGCT. Inner Left Sequence: ACTCAGTTTGGGTGCGAAAG. Inner Right Sequence: TTGTTGGGTGTTTCCATTCA. Inner Primer PCR Length: 2347 bp. Deletion Size: 1265 bp. Deletion left flank: CATTCATTGTGATATTTTTAAGTGAACCGT. Deletion right flank: ATTGTTCAAAATCCAATGAGACAATCCGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1559 C. elegans acr-2(ok1887) X. Show Description
K11G12.2. Homozygous. Outer Left Sequence: GGGTCCGTCCTTTAGACCAT. Outer Right Sequence: TGTTGTTGCTGGAGCAATTC. Inner Left Sequence: CCCTGCATATGTGTGAAACG. Inner Right Sequence: CGCTTTTCCAGTTTTTGACC. Inner Primer PCR Length: 3281 bp. Deletion Size: 2857 bp. Deletion left flank: AAAGAAGTGAAGCGGCTCTACCACCCCGAC. Deletion right flank: AGAAATCATGTTTGGAAAACAAAAATATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1563 C. elegans T01C3(ok1897) V. Show Description
T01C3. Homozygous. Outer Left Sequence: CCTGGCTGTTACCCAAGTGT. Outer Right Sequence: GCTCACATGAAGTGCAGCAT. Inner Left Sequence: CGAGAAGGGAAATTCCACAA. Inner Right Sequence: TGTGTAGGCTCCCTAATGCC. Inner Primer PCR Length: 2419 bp. Deletion Size: 762 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807