Search Strains

More Fields
Strain Species Genotype Add
RB2341 C. elegans ubc-16(ok3177) I. Show Description
Y54E5B.4. Homozygous. Outer Left Sequence: AAGTTGTCGGAATTGGTTGG. Outer Right Sequence: TTGCGATTCGAAGAGAGCTT. Inner Left Sequence: CATTGTTCAATATGCACCCAA. Inner Right Sequence: TGGCCACAAAGAAGAAAAGG. Inner Primer PCR Length: 1138 bp. Deletion Size: 551 bp. Deletion left flank: TAAACACAATTTTTTTTCAGACGACAGTGT. Deletion right flank: GTGGGCGGCAAACGATTTTCCCGGAAAAAC. Insertion Sequence: ACAGTACCCACATTTGATAATATTTCGATACAAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2342 C. elegans adm-2(ok3178) X. Show Description
C04A11.4. Homozygous. Outer Left Sequence: GGGAGATCAAATTTCGGTGA. Outer Right Sequence: CGATTGGCGGAAATTCTAAA. Inner Left Sequence: TCCAGATTCAAAAGAGACGTTG. Inner Right Sequence: CCACTGAGCGTAGTCCACCT. Inner Primer PCR Length: 1253 bp. Deletion Size: 989 bp. Deletion left flank: CTTGATGACGTGGGTGTTCCTATACAAAAA. Deletion right flank: TTTGTATAAAAATAGAGAAAAATATCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2343 C. elegans try-13(ok3179) V. Show Description
F25E5.7. Homozygous. Outer Left Sequence: TTCGGCAATATGCCCTTAAC. Outer Right Sequence: CGCGGCTGAAGACTTTAGTT. Inner Left Sequence: CCTTTCCTCCAACGAAGAATC. Inner Right Sequence: TGACATTGCATACCAGGAGAA. Inner Primer PCR Length: 1222 bp. Deletion Size: 631 bp. Deletion left flank: TTTCAGTATTACGTTCAAAAAGATGGGAAA. Deletion right flank: GAACATGAACTGCAATGCGAATCCACAGAA. Insertion Sequence: AAAAAAACATTTTGATTAATTTCAGAATTTTGATAAATTTCAAAACATTTGATTAATTT CAGTATGACTCCGGAGGTAGTGCAATAAGCAACGTTTCCGGACAAAATACCGTTCTTGG AGTGTATGTAACAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2344 C. elegans C49C3(ok3180) IV. Show Description
C49C3. Homozygous. Outer Left Sequence: TCCCTTAAAACGTGCAATGA. Outer Right Sequence: CCAAATTCCTCCTGTTTGGA. Inner Left Sequence: TCAATTCAGTGCATGCTTCA. Inner Right Sequence: CTTCTTCAGCAAACGAAGCC. Inner Primer PCR Length: 1310 bp. Deletion Size: 281 bp. Deletion left flank: AAAAAAGAAAAAGAAAGTTCGAAAATGTGT. Deletion right flank: AAAGAGTAATTTTTTCGAAATTTGAAATCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2345 C. elegans clec-29(ok3181) V. Show Description
T25E12.9. Homozygous. Outer Left Sequence: CTGGAGGGAGACCAAATTGA. Outer Right Sequence: ATTTTCTAGCAAGGCAGCCA. Inner Left Sequence: TGCAAATGAACCAACTCCTG. Inner Right Sequence: CTGCAAACCATGACAACTTCA. Inner Primer PCR Length: 1140 bp. Deletion Size: 549 bp. Deletion left flank: AGAGTGTCAGCACGAATCGGTTCTCGTTTC. Deletion right flank: GTGTAGATCCACCGAGGTTCATGCAAGCCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2346 C. elegans prkl-1(ok3182) IV. Show Description
ZK381.5. Homozygous. Outer Left Sequence: TCGGGATACCCAGTAAGCAG. Outer Right Sequence: CCTCCAATTGTGCTTCTTCG. Inner Left Sequence: AATAGTCTCCCAGGGCCAAG. Inner Right Sequence: CACGTTCACAATTGTAATTCTCGT. Inner Primer PCR Length: 1264 bp. Deletion Size: 649 bp. Deletion left flank: TCCATAATAACAAGAGTTGAAAAAGCAAAT. Deletion right flank: TTTCGGGTTTAAATTGTATACCTCTGCATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2347 C. elegans idh-2(ok3183) X. Show Description
C34F6.8. Homozygous. Outer Left Sequence: TTCAAGTTTGCAGGTCACCA. Outer Right Sequence: GGTTCCCTTCTTGGTTCCAT. Inner Left Sequence: CCCATGCAATTCTTGAGCAC. Inner Right Sequence: TTTTTCCCTCCTCGACAGTG. Inner Primer PCR Length: 1324 bp. Deletion Size: 597 bp. Deletion left flank: GAACTACGACGGAGATGTGCAAAGTGACAT. Deletion right flank: GCATTGACACTGTCGAGGAGGGAAAAATGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2348 C. elegans idh-2(ok3184) X. Show Description
C34F6.8. Homozygous. Outer Left Sequence: TTCAAGTTTGCAGGTCACCA. Outer Right Sequence: GGTTCCCTTCTTGGTTCCAT. Inner Left Sequence: CCCATGCAATTCTTGAGCAC. Inner Right Sequence: TTTTTCCCTCCTCGACAGTG. Inner Primer PCR Length: 1324 bp. Deletion Size: 716 bp. Deletion left flank: TCCAATACGCATTGATGAAGCAATGGCCAC. Deletion right flank: CTGTGGGCAACTTTCACAACAATTAAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2349 C. elegans pgp-3(ok3187) X. Show Description
ZK455.7. Homozygous. Outer Left Sequence: GCGAATGCTCTTATGGAAGG. Outer Right Sequence: TTGCAAATGAACTCGTGAGC. Inner Left Sequence: CGTTATGCGAACGACGACTA. Inner Right Sequence: ATTCGGATGTTTTCAGCGAC. Inner Primer PCR Length: 1151 bp. Deletion Size: 573 bp. Deletion left flank: CCGGTGGAATGGCAAATGAAGTAATTGCTG. Deletion right flank: CAAGCATTGGACTTTTGATGAGATTTTATA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2350 C. elegans clec-43(ok3188) II. Show Description
R07C3.1. Homozygous. Outer Left Sequence: ATGCAAGTTATGTGTGCGGA. Outer Right Sequence: GTTATTTGGAGAGGCTGCCA. Inner Left Sequence: TTTTGTGGGCCTGAGTTTTT. Inner Right Sequence: GCCGCATTATACATTCGGATA. Inner Primer PCR Length: 1270 bp. Deletion Size: 706 bp. Deletion left flank: TCCTCAGATGGAGATTATTCCTACTACAGC. Deletion right flank: ATAAGATCTATAACTCTACTACAAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2352 C. elegans C29F3.5(ok3190) V. Show Description
C29F3.5 Homozygous. Outer Left Sequence: cgttcaactcaccagatcca. Outer Right Sequence: ttcgcgccaagtctaatttt. Inner Left Sequence: ctgcccagtcaaaatcacatt. Inner Right Sequence: aggagtgatggaccaattttt. Inner Primer PCR Length: 1298. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2353 C. elegans Y110A7A.20(ok3191) I. Show Description
Y110A7A.20 Homozygous. Outer Left Sequence: gaatcaacaaatgcagtgcg. Outer Right Sequence: tgaaaacagaaccatcgtcg. Inner Left Sequence: tccaaccaaaaattgcttca. Inner Right Sequence: aaatgctcaaaagaatcccg. Inner Primer PCR Length: 1223. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2354 C. elegans F15D4.4(ok3200) II. Show Description
F15D4.4 Homozygous. Outer Left Sequence: ggtagatttaaagcgcgtcg. Outer Right Sequence: ttccggaaatatgcaggaag. Inner Left Sequence: agcgcgaaaaattcaatgag. Inner Right Sequence: gttcaattccggcagtttg. Inner Primer PCR Length: 1171. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2355 C. elegans lev-1(ok3201) IV. Show Description
F09E8.7 Homozygous. Outer Left Sequence: atcgattgctcgttgagctt. Outer Right Sequence: gctcgactttctcacttcgg. Inner Left Sequence: gctcatcatccagctcatca. Inner Right Sequence: ccgtgtcgatttttcggaat. Inner Primer PCR Length: 1300. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2356 C. elegans C24B9.9(ok3202) V. Show Description
C24B9.9 Homozygous. Outer Left Sequence: ttatttctgggctcgcattc. Outer Right Sequence: agtagttgcggctgagttcc. Inner Left Sequence: ggtcgaagtgatacctgtgga. Inner Right Sequence: tgacattttgaagcaaatcaatg. Inner Primer PCR Length: 1238. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2357 C. elegans F41H10.6(ok3203) IV. Show Description
F41H10.6 Homozygous. Outer Left Sequence: ggggtgatttcgggtctaat. Outer Right Sequence: tccaacactcatcggattca. Inner Left Sequence: agtgaagtccgagacggaaa. Inner Right Sequence: agtatgcccaacacatccg. Inner Primer PCR Length: 1139. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2358 C. elegans Y54G2A.25(ok3204) IV. Show Description
Y54G2A.25 Homozygous. Outer Left Sequence: gcatcgcaaacgagacataa. Outer Right Sequence: cttaggcattaggcaggcag. Inner Left Sequence: atgcgcactgtagttggtga. Inner Right Sequence: acaagtcaagcgtgtaggca. Inner Primer PCR Length: 1151. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2359 C. elegans Y54G2A.25(ok3205) IV. Show Description
Y54G2A.25 Homozygous. Outer Left Sequence: gcatcgcaaacgagacataa. Outer Right Sequence: cttaggcattaggcaggcag. Inner Left Sequence: atgcgcactgtagttggtga. Inner Right Sequence: acaagtcaagcgtgtaggca. Inner Primer PCR Length: 1151. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2360 C. elegans ZC477.2(ok3206) IV. Show Description
ZC477.2 Homozygous. Outer Left Sequence: agtgaatgaaggagcggaaa. Outer Right Sequence: cttgtaggcatgaaggggaa. Inner Left Sequence: tcctcgatcgattgaatgc. Inner Right Sequence: acgccggaacttctgactct. Inner Primer PCR Length: 1236. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2361 C. elegans nas-24(ok3207) V. Show Description
F20G2.4 Homozygous. Outer Left Sequence: ggagtggttcagctggagag. Outer Right Sequence: aaaacgattgcagaaaacgg. Inner Left Sequence: atggagactggatggtgtgc. Inner Right Sequence: caatgatggttgggttgtga. Inner Primer PCR Length: 1114. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2362 C. elegans abf-5(ok3208) X. Show Description
T22H6.5 Homozygous. Outer Left Sequence: gagatgagtcaggaccgagc. Outer Right Sequence: atcccattgcctcaccaata. Inner Left Sequence: ctgccactattgtcacaaaatct. Inner Right Sequence: gccaactctttctcagcacc. Inner Primer PCR Length: 1198. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2363 C. elegans Y51H4A.13(ok3209) IV. Show Description
Y51H4A.13 Homozygous. Outer Left Sequence: aagccagtagatgtcgggtg. Outer Right Sequence: gccagaaccctgtgaatgat. Inner Left Sequence: tacagcgtccgacatctcac. Inner Right Sequence: tcgaattttcgacaaatcaataa. Inner Primer PCR Length: 1264. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2364 C. elegans D2023.6(ok3210) V. Show Description
D2023.6 Homozygous. Outer Left Sequence: tgtcaacggaggtgttttca. Outer Right Sequence: actatctgaacggcgaatgg. Inner Left Sequence: aacacatttcgggaatggaa. Inner Right Sequence: aaaaacggcagaaagaccaa. Inner Primer PCR Length: 1204. Deletion size: about 700bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2365 C. elegans vit-2(ok3211) X. Show Description
C42D8.2 Homozygous. Outer Left Sequence: atggagcacgctcttgctat. Outer Right Sequence: tgggatctttccagagatgg. Inner Left Sequence: tcacatggaaaacgaggaca. Inner Right Sequence: gctcttggttgagaagacgg. Inner Primer PCR Length: 1222. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2366 C. elegans T12B3.4(ok3212) IV. Show Description
T12B3.4 Homozygous. Outer Left Sequence: gatggctccagaagacgttc. Outer Right Sequence: cactgaaaaatgtgcgtggt. Inner Left Sequence: tttttgttgggtccttcttttt. Inner Right Sequence: tgatatcttggcatttggga. Inner Primer PCR Length: 1166. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2367 C. elegans srh-49(ok3217) I. Show Description
C10G11.4 Homozygous. Outer Left Sequence: caatgtccttcccaacatca. Outer Right Sequence: ttaatttttgaattcgcccg. Inner Left Sequence: caagattattatgctacaaactacacg. Inner Right Sequence: gttccagcatctctcctcgt. Inner Primer PCR Length: 1357. Deletion size: about 500bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2368 C. elegans R03G8.6(ok3218) X. Show Description
R03G8.6 Homozygous. Outer Left Sequence: tgacatacgactcgacccaa. Outer Right Sequence: cggttttcaattgcgttttt. Inner Left Sequence: cggtccctagtaagctccaa. Inner Right Sequence: tgttgattttgcaaccgaaa. Inner Primer PCR Length: 1289. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2369 C. elegans haf-6(ok3219) I. Show Description
Y48G8AL.11 Homozygous. Outer Left Sequence: tttgacaccacacggaaaaa. Outer Right Sequence: tcacgttaagtattcccggc. Inner Left Sequence: aaaaacctcggccaccac. Inner Right Sequence: ttcgtgtcgagaccgaacta. Inner Primer PCR Length: 1195. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2370 C. elegans T21B6.5(ok3220) X. Show Description
T21B6.5 Homozygous. Outer Left Sequence: tgagcaatggattacaaccg. Outer Right Sequence: atgtccggagcttaatggtg. Inner Left Sequence: tgcgcggtaattggaaat. Inner Right Sequence: gagcactatcagtgggggaa. Inner Primer PCR Length: 1365. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2371 C. elegans nhl-3(ok3223) II. Show Description
W04H10.3 Homozygous. Outer Left Sequence: cacgtagcttcgggtcattt. Outer Right Sequence: aagaaatttgcattggagcg. Inner Left Sequence: agtctagcagatccacatggc. Inner Right Sequence: gtgacgccagcacattctta. Inner Primer PCR Length: 1246. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2372 C. elegans K06A1.5(ok3224) II. Show Description
K06A1.5 Homozygous. Outer Left Sequence: ccgcagatccagatatgaca. Outer Right Sequence: tttctcgtacgcattgcatc. Inner Left Sequence: ccgtatggccagaaaacgta. Inner Right Sequence: ttgcaagacatgtgcaatagg. Inner Primer PCR Length: 1190. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2374 C. elegans cnc-2(ok3226) V. Show Description
R09B5.3 Homozygous. Outer Left Sequence: accactcctttggtctcgaa. Outer Right Sequence: tcgacgtcatcatttggttc. Inner Left Sequence: ttttggaagtcgaccgaaac. Inner Right Sequence: catatcagttgtgagtatcaatggaa. Inner Primer PCR Length: 1164. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2375 C. elegans lmp-1(ok3228) X. Show Description
C03B1.12 Homozygous. Outer Left Sequence: caattttggttggagaggga. Outer Right Sequence: tcacattcaactcgcgtagc. Inner Left Sequence: cgtaaagtcatcgtacgggc. Inner Right Sequence: gctctgctctcgtagcacaa. Inner Primer PCR Length: 1217. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2376 C. elegans R06C7.4(ok3229) I. Show Description
R06C7.4 Homozygous. Outer Left Sequence: ttcagtttgatctaccccgc. Outer Right Sequence: tggaactgatccgaatgtca. Inner Left Sequence: cacaatcgcattccaacaaa. Inner Right Sequence: tcgagaacacgacggttatg. Inner Primer PCR Length: 1239. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2377 C. elegans R07B7.11(ok3230) V. Show Description
R07B7.11 Homozygous. Outer Left Sequence: ttggtcggaaatggaaagag. Outer Right Sequence: tctccgaaatcaaatcgtcc. Inner Left Sequence: cagtggaatgaaggctttgg. Inner Right Sequence: ttgagactgttctctttcaaattca. Inner Primer PCR Length: 1197. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2378 C. elegans msh-6(ok3231) I. Show Description
Y47G6A.11 Homozygous. Outer Left Sequence: accgctaggattttcggatt. Outer Right Sequence: gcccctgagttgcaaaatta. Inner Left Sequence: tggtattcggtatcaggagca. Inner Right Sequence: gcctctttcctgtgcacttt. Inner Primer PCR Length: 1282. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2379 C. elegans F55B11.1(ok3234) IV. Show Description
F55B11.1 Homozygous. Outer Left Sequence: acttgcgcacaaacattcag. Outer Right Sequence: ccaaaaagtcaatgcagggt. Inner Left Sequence: gcattgtttcatcgtttcca. Inner Right Sequence: cagtttcacgcaattgatttt. Inner Primer PCR Length: 1211. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2380 C. elegans Y48E1B.1(ok3235) II. Show Description
Y48E1B.1 Homozygous. Outer Left Sequence: aaatttgggaaaagcccaat. Outer Right Sequence: cgggaatgttaggggaaaat. Inner Left Sequence: tgaatttccgtcatttgaagc. Inner Right Sequence: tcctttggaaaatttcgttaaaa. Inner Primer PCR Length: 1192. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2381 C. elegans Y87G2A.12(ok3238) I. Show Description
Y87G2A.12 Homozygous. Outer Left Sequence: tggaccctctacccctttct. Outer Right Sequence: tttgctttgctcgaatgatg. Inner Left Sequence: tgaagaacaactgcacccag. Inner Right Sequence: atgtgcttcagcatcattcg. Inner Primer PCR Length: 1242. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2382 C. elegans vit-5(ok3239) X. Show Description
C04F6.1 Homozygous. Outer Left Sequence: cattgaaaccacattggctg. Outer Right Sequence: ggttgttggaattctgcgtt. Inner Left Sequence: gctggaaccaagaacaccat. Inner Right Sequence: gaagctcgaacttggagtcg. Inner Primer PCR Length: 1272. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2383 C. elegans F53H8.3(ok3241) X. Show Description
F53H8.3 Homozygous. Outer Left Sequence: gcggtaccagtttcgttctt. Outer Right Sequence: ctcctccacgtccaatcaat. Inner Left Sequence: gcaatcaaccagtacaaaagtagaa. Inner Right Sequence: ggaaatggcgaaattgaaaa. Inner Primer PCR Length: 1369. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2384 C. elegans Y34B4A.8(ok3242) X. Show Description
Y34B4A.8 Homozygous. Outer Left Sequence: ttatgggggatgaagctttg. Outer Right Sequence: tggagtaccccttgatgagc. Inner Left Sequence: aaatttcagtcatttggccg. Inner Right Sequence: cgattcaaaaagaaagaatatccg. Inner Primer PCR Length: 1147. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2385 C. elegans E03H4.8(ok3244) I. Show Description
E03H4.8 Homozygous. Outer Left Sequence: aattgtactgtgtgcggcaa. Outer Right Sequence: gccagacgggattttgtcta. Inner Left Sequence: tttcgaaatttgccgagc. Inner Right Sequence: ttttcaaactttccggtcaaa. Inner Primer PCR Length: 1283. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2386 C. elegans C37H5.3(ok3245) V. Show Description
C37H5.3 Homozygous. Outer Left Sequence: gtagatcatctcgccccaaa. Outer Right Sequence: atatttctcgccctgccttc. Inner Left Sequence: catcagacccagaaactgcc. Inner Right Sequence: aatttgctggccaggtgtat. Inner Primer PCR Length: 1379. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2387 C. elegans R05H5.7(ok3246) II. Show Description
R05H5.7 Homozygous. Outer Left Sequence: cgaagttttgagcttttggc. Outer Right Sequence: tcgaaaagaccgaattgctt. Inner Left Sequence: tttgattttaattgtggtaactacgg. Inner Right Sequence: ggtcacaggtgtgttgtgct. Inner Primer PCR Length: 1120. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2388 C. elegans W04G3.1(ok3253) X. Show Description
W04G3.1 Homozygous. Outer Left Sequence: aacgcattgaaccccactta. Outer Right Sequence: agctaacccaattctcgcct. Inner Left Sequence: caccgtgccctaattactca. Inner Right Sequence: actagtgcgccctacaggag. Inner Primer PCR Length: 1191. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2389 C. elegans grd-14(ok3254) X. Show Description
T01B10.2 Homozygous. Outer Left Sequence: tctgccacagtatttgctgc. Outer Right Sequence: gcgaatccaatgagaaggag. Inner Left Sequence: tatgatgacctcccaaagcc. Inner Right Sequence: cgctgctgaatacacaccat. Inner Primer PCR Length: 1246. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2391 C. elegans grl-29(ok3261) V. Show Description
T24A6.18 Homozygous. Outer Left Sequence: aaggtctattcactggcgga. Outer Right Sequence: ccggccaattctaaacaaag. Inner Left Sequence: gaattgaattaggcaacgacaa. Inner Right Sequence: tgctcaataatcggaaacca. Inner Primer PCR Length: 1189. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2392 C. elegans F39B2.1(ok3262) I. Show Description
F39B2.1 Homozygous. Outer Left Sequence: gatccatcacgccaactttt. Outer Right Sequence: aaattcggtagatttgggca. Inner Left Sequence: gcaaggacgagttcgttgat. Inner Right Sequence: tctttggatcgtcttgaatgc. Inner Primer PCR Length: 1132. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2393 C. elegans ptr-20(ok3263) II. Show Description
Y53F4B.28 Homozygous. Outer Left Sequence: acctaagccaagccctaagc. Outer Right Sequence: gacctgagaaaatgcaaggc. Inner Left Sequence: gcctaagcctgtgcctaaaa. Inner Right Sequence: tttggacagctttaattccga. Inner Primer PCR Length: 1185. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807