| RB2181 |
C. elegans |
ZK643.3(ok2957) III. Show Description
ZK643.3. Homozygous. Outer Left Sequence: AACTCGCAAAGCTCCAAAAA. Outer Right Sequence: TCGCTTCAAGACCCAGTACC. Inner Left Sequence: CTATTCTAACGGCTCGCCAA. Inner Right Sequence: CCGATCCATTTCAATTTGCT. Inner Primer PCR Length: 1177 bp. Deletion Size: 534 bp. Deletion left flank: CTCATCTCATGTCTCTTATACGGAGCATTC. Deletion right flank: ATAGAATTCCAAGCATTGGATAATGATTAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2182 |
C. elegans |
ZK632.3(ok2958) III. Show Description
ZK632.3. Homozygous. Outer Left Sequence: CGCTCATCGTCAGTGAAAAA. Outer Right Sequence: GTCAGTTTTGCGGATGTCCT. Inner Left Sequence: CCCATTCCACGTTTTTGAGT. Inner Right Sequence: ACTTGCTCTTCAACGCCATT. Inner Primer PCR Length: 1108 bp. Deletion Size: 371 bp. Deletion left flank: GCCGACCATATCGCCTGTTGGAAGGGTGTT. Deletion right flank: AAGACGAGAATTCGTTGCATTTTCCTCATC. Insertion Sequence: TCCCTTCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2183 |
C. elegans |
grl-16(ok2959) I. Show Description
Y65B4BR.6. Homozygous. Outer Left Sequence: AACTGAAGTGTGGGTGAGGG. Outer Right Sequence: TCATTCGGAAATGAACACGA. Inner Left Sequence: GGAGTGGTGCGAATCTGACT. Inner Right Sequence: CTTCCCCCTATTCTGCAACA. Inner Primer PCR Length: 1236 bp. Deletion Size: 473 bp. Deletion left flank: TCCGGCGTTGTAGCCTCCTTGTGGGGCGAC. Deletion right flank: AAGTAGAATGGACTTTGTCGCTCCTTAAGG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2184 |
C. elegans |
clc-32(ok2960) V. Show Description
F10A3.1. Homozygous. Outer Left Sequence: TGCGGACTGCAAATAAAGTG. Outer Right Sequence: CGTGTGCTTTGTACGCTGAT. Inner Left Sequence: TCCCGTTTCTACTTGGTTTTT. Inner Right Sequence: TTCCGAAACAAAATGCACAA. Inner Primer PCR Length: 1208 bp. Deletion Size: 327 bp. Deletion left flank: TTCAGGGTAAGCACTAAATTGAGTTCCGTG. Deletion right flank: GTGTGTAAGCAAGTGCGTTATGAAATTGTG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2185 |
C. elegans |
glt-4(ok2961) X. Show Description
T22E5.2. Homozygous. Outer Left Sequence: GCCTCATTGGATTCTGGAAC. Outer Right Sequence: TTTTATCGGATTACGGCGAG. Inner Left Sequence: GCAGGAAGATTAGGAATGGTG. Inner Right Sequence: GCCAAAAAGCTCAAAATTGG. Inner Primer PCR Length: 1130 bp. Deletion Size: 343 bp. Deletion left flank: ATCGGATGGGTCATTATGTAATATTGAAAT. Deletion right flank: TTAATCTTGACTCGAATCGAGAATGATAGG. Insertion Sequence: TTAATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2186 |
C. elegans |
H25K10.5(ok2962) IV. Show Description
H25K10.5. Homozygous. Outer Left Sequence: TGGGCCCTAACGCATACTAC. Outer Right Sequence: CCGGTTGTACAGCCCTACTC. Inner Left Sequence: CGGTTATCTAGGTGTGGCCT. Inner Right Sequence: AGGCGAAACTCACTACATCCA. Inner Primer PCR Length: 1227 bp. Deletion Size: 570 bp. Deletion left flank: TGATAAAACTCACTTCCACACTTTCGAGCC. Deletion right flank: TGTCACATAGAAAACGAAAGTATAATCCTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2187 |
C. elegans |
lgc-47(ok2963) X. Show Description
F47A4.1. Homozygous. Outer Left Sequence: GCCCGAAGAAGATTACCAAA. Outer Right Sequence: ACGACCCAACGAACAGAAAC. Inner Left Sequence: TCCTTTCATTCTTTTGCTCACA. Inner Right Sequence: AAGCGGAAAGTGTTTCTCCTC. Inner Primer PCR Length: 1179 bp. Deletion Size: 521 bp. Deletion left flank: GTCATATAGGTTGGAATGTAACCTTGCAAG. Deletion right flank: TACTAAAGTTTGTCATTGTGAAATCAGGTA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2188 |
C. elegans |
flp-20(ok2964) X. Show Description
E01H11.3 Homozygous. Outer Left Sequence: ccgattgccaaaacgattac. Outer Right Sequence: agcccgcttccttcatagtt. Inner Left Sequence: tcatgaagctatcggaagatca. Inner Right Sequence: tcctccatcaccagacaaca. Inner Primer PCR Length: 1194. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2189 |
C. elegans |
Y41E3.3(ok2969) IV. Show Description
Y41E3.3 Homozygous. Outer Left Sequence: ctcggcacatatttcggttt. Outer Right Sequence: atatgcccagtcaactccca. Inner Left Sequence: gaaattttcccgaactttcaa. Inner Right Sequence: aaaaagtttcccaaaaaccg. Inner Primer PCR Length: 1098. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2191 |
C. elegans |
C35D10.11(ok2971) III. Show Description
C35D10.11 Homozygous. Outer Left Sequence: ttacatgggtgcaaatgtcg. Outer Right Sequence: ataccccaacataatgccca. Inner Left Sequence: ttcagcttctccgccactac. Inner Right Sequence: caactgaacacgtcattgtgg. Inner Primer PCR Length: 1257. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2192 |
C. elegans |
grd-10(ok2972) IV. Show Description
F09D12.1 Homozygous. Outer Left Sequence: tcgtcatctttttgtcgctg. Outer Right Sequence: attgaaccaatagttgcggg. Inner Left Sequence: ttcttgtgttccaaaagggc. Inner Right Sequence: ttgagatagggtaaaagaagatcg. Inner Primer PCR Length: 1202. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2193 |
C. elegans |
F44G3.2(ok2973) V. Show Description
F44G3.2 Homozygous. Outer Left Sequence: tgcacagattggtcttcgac. Outer Right Sequence: aggtccaaatgatgtcagcc. Inner Left Sequence: tttcaactctgtgtcttggca. Inner Right Sequence: ccgcattattcgttaagggt. Inner Primer PCR Length: 1144. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2194 |
C. elegans |
math-33(ok2974) V. Show Description
H19N07.2 Homozygous. Outer Left Sequence: gaaagttcgcggactgaatc. Outer Right Sequence: cttgtcggtcattgtgtcgt. Inner Left Sequence: cgtgcattcgaagcttacac. Inner Right Sequence: cgaaaaatagaaggtcccct. Inner Primer PCR Length: 1180. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2195 |
C. elegans |
C16E9.2(ok2975) X. Show Description
C16E9.2 Homozygous. Outer Left Sequence: tgttgctgaagcaattcgac. Outer Right Sequence: ccccctttgaaaacaagaca. Inner Left Sequence: gttggcaacacagcaaggta. Inner Right Sequence: cagctcgttctcctcgtttc. Inner Primer PCR Length: 1373. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2196 |
C. elegans |
K08D10.14(ok2976) IV. Show Description
K08D10.14 Homozygous. Outer Left Sequence: aatttagcgtacgccactcg. Outer Right Sequence: aggagaatgtggtaaggcga. Inner Left Sequence: agcacgcgctttgtgttt. Inner Right Sequence: agaccaaattctgtgggtgtg. Inner Primer PCR Length: 1275. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2197 |
C. elegans |
srw-99(ok2977) V. Show Description
Y46H3C.2 Homozygous. Outer Left Sequence: tttcgtcgctgtagttcgtg. Outer Right Sequence: gggaattcctggccatttac. Inner Left Sequence: gctggcaagcgtcagatac. Inner Right Sequence: cagtggcgagcgttaacata. Inner Primer PCR Length: 1122. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2198 |
C. elegans |
C27B7.7(ok2978) IV. Show Description
C27B7.7 Homozygous. Outer Left Sequence: catgacgtcggttacactgg. Outer Right Sequence: ctccgggtcctgaaacatta. Inner Left Sequence: gccaaatctgtttgaagaactg. Inner Right Sequence: gcatggattcgtgtcttcct. Inner Primer PCR Length: 1143. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2199 |
C. elegans |
K06A4.3(ok2979) V. Show Description
K06A4.3 Homozygous. Outer Left Sequence: gccaccagagagtggaagac. Outer Right Sequence: gaaatacgatggttgtgggg. Inner Left Sequence: gaatcaagggaatggctcgt. Inner Right Sequence: gttctgcacggatcgaactt. Inner Primer PCR Length: 1119. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2200 |
C. elegans |
gst-24(ok2980) II. Show Description
F37B1.1 Homozygous. Outer Left Sequence: gcgacgattcatggtctttt. Outer Right Sequence: ctctccctcccctcaatttc. Inner Left Sequence: caaactccccaggtgtgact. Inner Right Sequence: ggagattttcgaaacgactttg. Inner Primer PCR Length: 1156. Deletion size: about 600 bp. ttggtcagctcccattcctc [ 603 bp deletion] caagttatctaggcacgagg -- Wild type ttggtcagctcccattcctc ------------------ caagttatctaggcacgagg -- ok2980 Sequence shown is on the minus strand. Deletion starts in the second exon and removes the downstream part of that exon, the 3'-UTR, and approximately 0.1 kb of downstream flanking sequence. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2201 |
C. elegans |
M60.6(ok2981) X. Show Description
M60.6 Homozygous. Outer Left Sequence: cacgtacgaaaccccaaagt. Outer Right Sequence: agttgcacaatccttttcgc. Inner Left Sequence: ttctcctgagaaagaatttggttt. Inner Right Sequence: gttatcggaaacaacgacgg. Inner Primer PCR Length: 1302. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2202 |
C. elegans |
vit-4(ok2982) X. Show Description
F59D8.2 Homozygous. Outer Left Sequence: cagcgtgagcattttgagaa. Outer Right Sequence: caaagctgaggtcaacccat. Inner Left Sequence: cgaagacggtttcgaatgat. Inner Right Sequence: tcaaggctatcgagatagagca. Inner Primer PCR Length: 1165. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2203 |
C. elegans |
F01G12.6(ok2983) X. Show Description
F01G12.6 Homozygous. Outer Left Sequence: ttgggacgagaaaatgaagg. Outer Right Sequence: ccaagttgagggtctcggta. Inner Left Sequence: ttgtgcatgggagaagttga. Inner Right Sequence: tgcaacattcataaaaatgcaa. Inner Primer PCR Length: 1279. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2204 |
C. elegans |
W10G6.1(ok2984) X. Show Description
W10G6.1 Homozygous. Outer Left Sequence: tgcatgcaactggaaacatt. Outer Right Sequence: ttatcacgtcggaagaggct. Inner Left Sequence: tgtgaatcagcagaaatgtcaa. Inner Right Sequence: accttcaactgcaggacgat. Inner Primer PCR Length: 1190. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2205 |
C. elegans |
hex-2(ok2985) V. Show Description
C14C11.3 Homozygous. Outer Left Sequence: acactcggttttcggctatg. Outer Right Sequence: tttcccaccaagcacctaac. Inner Left Sequence: atttccagaatccttgcgtg. Inner Right Sequence: agcgcatttttctgcatctc. Inner Primer PCR Length: 1120. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2206 |
C. elegans |
T25D3.3(ok2986) II. Show Description
T25D3.3 Homozygous. Outer Left Sequence: caaaattggagccaaaggaa. Outer Right Sequence: tctcgaacgtcttcgtgatg. Inner Left Sequence: gacccgagagcgtgatttta. Inner Right Sequence: ttggtgacaaaatgttcgga. Inner Primer PCR Length: 1186. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2207 |
C. elegans |
K08F8.1(ok2987) II. Show Description
K08F8.1 Homozygous. Outer Left Sequence: cagaatcacgccatgagcta. Outer Right Sequence: tcgtgtgggaacgcataata. Inner Left Sequence: tggtgattgggggttaagaa. Inner Right Sequence: agcgacacctttcatcgagt. Inner Primer PCR Length: 1298. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2208 |
C. elegans |
H22K11.2(ok2990) X. Show Description
H22K11.2 Homozygous. Outer Left Sequence: cttggtggctcatcaggaat. Outer Right Sequence: gtaaagggcaccctgaacaa. Inner Left Sequence: ggaaagtaccggagcagtga. Inner Right Sequence: ttggcacgtttttaattttgg. Inner Primer PCR Length: 1266. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2209 |
C. elegans |
ZK1240.2(ok2991) II. Show Description
ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2210 |
C. elegans |
C04G2.8(ok2992) IV. Show Description
C04G2.8 Homozygous. Outer Left Sequence: tgtcctgggtaggttgggta. Outer Right Sequence: atcccgaatctgtccaatca. Inner Left Sequence: gaccttttcacgaggcaatc. Inner Right Sequence: ggtccttcgacaaccatagc. Inner Primer PCR Length: 1314. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2211 |
C. elegans |
F44G3.2(ok2993) V. Show Description
F44G3.2 Homozygous. Outer Left Sequence: tgcacagattggtcttcgac. Outer Right Sequence: aggtccaaatgatgtcagcc. Inner Left Sequence: tttcaactctgtgtcttggca. Inner Right Sequence: ccgcattattcgttaagggt. Inner Primer PCR Length: 1144. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2212 |
C. elegans |
M02D8.1(ok2994) X. Show Description
M02D8.1 Homozygous. Outer Left Sequence: gataaaccacttgccggaga. Outer Right Sequence: tgtgcatgggacacaaagtt. Inner Left Sequence: ccgatggagagaacagctcta. Inner Right Sequence: tcgaaaatcagaagcaacga. Inner Primer PCR Length: 1159. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2213 |
C. elegans |
C09F9.2(ok2995) II. Show Description
C09F9.2 Homozygous. Outer Left Sequence: aatccactgctccaacaacc. Outer Right Sequence: gtgactccatcctcctggaa. Inner Left Sequence: aagtgtgaacggggatgtct. Inner Right Sequence: aggtgtagccttcgatggtg. Inner Primer PCR Length: 1257. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2214 |
C. elegans |
C16E9.2(ok2996) X. Show Description
C16E9.2 Homozygous. Outer Left Sequence: tgttgctgaagcaattcgac. Outer Right Sequence: ccccctttgaaaacaagaca. Inner Left Sequence: gttggcaacacagcaaggta. Inner Right Sequence: cagctcgttctcctcgtttc. Inner Primer PCR Length: 1373. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2215 |
C. elegans |
F40F9.2(ok2997) V. Show Description
F40F9.2 Homozygous. Outer Left Sequence: tcgctactttcccgcttaaa. Outer Right Sequence: tttcagtttgccatcacagc. Inner Left Sequence: tcgtaattatttgtgaaatgaaactt. Inner Right Sequence: cagaaccgtttcaggattgg. Inner Primer PCR Length: 1253. Deletion size: about 800bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2216 |
C. elegans |
K07C6.4(ok2998) V. Show Description
K07C6.4 Homozygous. Outer Left Sequence: aattctctgctcgtcggaaa. Outer Right Sequence: tcaatatgcacacagcgaca. Inner Left Sequence: tcgaggccgaagataaggat. Inner Right Sequence: gctttttaggctttctcgtgg. Inner Primer PCR Length: 1143. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2217 |
C. elegans |
R08C7.6(ok2999) IV. Show Description
R08C7.6 Homozygous. Outer Left Sequence: acggaacatttttcaaggca. Outer Right Sequence: accccaccaatcaacgataa. Inner Left Sequence: gcgacatttgcacaattaca. Inner Right Sequence: gagttggacgccactgattt. Inner Primer PCR Length: 1201. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2218 |
C. elegans |
jac-1(ok3000) IV. Show Description
Y105C5B.21. Homozygous. Outer Left Sequence: ACATCTCACGGGTTCCACTC. Outer Right Sequence: TCGTAAGATTCAGCGCAATG. Inner Left Sequence: AAGTTCCCGATTCCTTGGAT. Inner Right Sequence: GCGTTCTACCAAAGCTACCG. Inner Primer PCR Length: 1249 bp. Deletion Size: 456 bp. Deletion left flank: CTCAAGGATCACAGGCTTCAACATATCCGC. Deletion right flank: AAACAAAGTTTTGAGCTTTTAACGTAAGTT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2219 |
C. elegans |
C28C12.9(ok3004) IV. Show Description
C28C12.9 Homozygous. Outer Left Sequence: tcgtcgatcaatcctgacaa. Outer Right Sequence: cgttaatacttcgtggccgt. Inner Left Sequence: caacgaagactctagggcgt. Inner Right Sequence: cccggccatattatttttga. Inner Primer PCR Length: 1333. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2220 |
C. elegans |
R13H9.5(ok3005) IV. Show Description
R13H9.5 Homozygous. Outer Left Sequence: aatgaactcaaaacgggacg. Outer Right Sequence: tgtaatgacgcttgtcggaa. Inner Left Sequence: cggttccagtccagtctgat. Inner Right Sequence: agtctttgcaggtaaatacgagtt. Inner Primer PCR Length: 1218. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2221 |
C. elegans |
Y113G7B.14(ok3006) V. Show Description
Y113G7B.14 Homozygous. Outer Left Sequence: ggacccctgacatgaacttg. Outer Right Sequence: gtctcgaaagtcgtcttggc. Inner Left Sequence: tgtccgacaatgagaatgga. Inner Right Sequence: tttcatcatcggaacaagca. Inner Primer PCR Length: 1147. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2222 |
C. elegans |
fkb-2(ok3007) I. Show Description
Y18D10A.19 Homozygous. Outer Left Sequence: agtcgaagctcacgattgct. Outer Right Sequence: cggagatttcgacttcaagg. Inner Left Sequence: ccgtagccaggagaaaaatg. Inner Right Sequence: ttatggagaggttgcacacg. Inner Primer PCR Length: 1148. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2223 |
C. elegans |
grd-10(ok3008) IV. Show Description
F09D12.1 Homozygous. Outer Left Sequence: tcgtcatctttttgtcgctg. Outer Right Sequence: attgaaccaatagttgcggg. Inner Left Sequence: ttcttgtgttccaaaagggc. Inner Right Sequence: ttgagatagggtaaaagaagatcg. Inner Primer PCR Length: 1202. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2224 |
C. elegans |
F38B6.6(ok3009) X. Show Description
F38B6.6 Homozygous. Outer Left Sequence: aaacgtgtaccgagattcgc. Outer Right Sequence: tggtgaatggatttgaagca. Inner Left Sequence: aacaaaactgaagttggattcagaaacaaaactgaagttggattcaga. Inner Right Sequence: gggatgcatttcctccatta. Inner Primer PCR Length: 1214. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2225 |
C. elegans |
col-179(ok3010) X. Show Description
C34F6.3 Homozygous. Outer Left Sequence: cctgccactaaagagaacgc. Outer Right Sequence: gcggaaacaaggattatgga. Inner Left Sequence: ggttgcaaagtgattgcaga. Inner Right Sequence: tggtaagaaacgttcacgca. Inner Primer PCR Length: 1291. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2226 |
C. elegans |
ZC416.2(ok3011) IV. Show Description
ZC416.2 Homozygous. Outer Left Sequence: ctggggtcaaaagtcggtta. Outer Right Sequence: gttaaaattgtctgccgcgt. Inner Left Sequence: tcccaaactccaatttccag. Inner Right Sequence: gcatcggggtgactcttact. Inner Primer PCR Length: 1235. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2227 |
C. elegans |
K06H6.3(ok3012) V. Show Description
K06H6.3 Homozygous. Outer Left Sequence: gcaaatactgaacccgcaat. Outer Right Sequence: ccgacgaatttttcagcatt. Inner Left Sequence: ttttatttcggattgccagg. Inner Right Sequence: ttttcaaagtagacgccttcaa. Inner Primer PCR Length: 1395. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2228 |
C. elegans |
klp-20(ok3013) III. Show Description
Y50D7A.6 Homozygous. Outer Left Sequence: atcacaacgggaatctggag. Outer Right Sequence: ttcaacggcaaaaatgttca. Inner Left Sequence: gaatttggaatcctcccgat. Inner Right Sequence: tcatatttctcacctcaatttctca. Inner Primer PCR Length: 1132. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2229 |
C. elegans |
cyn-7(ok3014) V. Show Description
Y75B12B.2 Homozygous. Outer Left Sequence: acttccggattgttgacctg. Outer Right Sequence: agctcatccgtgtgcttctt. Inner Left Sequence: gtgaagagctggcaacaatg. Inner Right Sequence: tgattcccgctctattaccg. Inner Primer PCR Length: 1175. Deletion size: about 600 bp. cyn-7 was formerly known as cyp-7. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2230 |
C. elegans |
ZC395.10(ok3015) III. Show Description
ZC395.10 Homozygous. Outer Left Sequence: cttgcccatggaaactgatt. Outer Right Sequence: caatgccattcgcacttaaa. Inner Left Sequence: gaaaaacgaatgcgggataa. Inner Right Sequence: tcttgcttgttattgccgtg. Inner Primer PCR Length: 1195. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2231 |
C. elegans |
F47A4.1(ok3016) X. Show Description
F47A4.1 Homozygous. Outer Left Sequence: gcccgaagaagattaccaaa. Outer Right Sequence: acgacccaacgaacagaaac. Inner Left Sequence: tcctttcattcttttgctcaca. Inner Right Sequence: aagcggaaagtgtttctcctc. Inner Primer PCR Length: 1179. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|