Search Strains

vrIs93 [mex-5p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].

vrIs121 [let-607(fosmid)::GFP + unc-119(+)]. let-607 locus in fosmid tagged at the carboxy-terminus with GFP. Derived by crossing the LET-607::GFP transgenic strain (YL529) to let-607(tm1423) mutants. vrIs121 transgene rescues the lethal mutant phenotype of let-607(tm1423) homozygous mutants. Reference: Weicksel SE, et al. Development. 2016 Oct 1;143(19):3540-3548.

wfIs232 [app-1p::mCherry::H2B::unc-54 + unc-119(+)]. mCherry::H2B expression in the nuclei of intestinal cells. YQ243 can serve as a control strain for YQ95. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.

wfIs120 [app-1p::atg-18::unc-54 + unc-119(+)]. Intestine-specific promoter app-1 drives atg-18 expression in the atg-18(gk378) mutant background, providing rescue in intestinal cells. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.

iaIs7 [nhr-57p::GFP + unc-119(+)] IV. Over-expression of nhr-57:GFP in vhl-1 mutant background. Reference: Shen C, et al. Genetics. 2006 Nov;174(3):1205-14.

iaIs7 [nhr-57p::GFP + unc-119(+)] IV. GFP expression is very weak. Reference: Shen C, et al. Genetics. 2006 Nov;174(3):1205-14.

iaIs38 contains [egl-9p::egl-9::tag + unc-119(+)]. Superficially WT. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

iaIs28 contains [hif-1p::hif-1a::tag + unc-119(+)]. Published in Zhang et al PLoS ONE 4: e6348 (2009).

iaEx101 contains [egl-9p::egl-9(H487A)::tag + unc-119(+)]. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.

fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

czIs110 [mex-5p::GFP::KDEL::pie-1 3’UTR + unc-119(+)]. GFP::KDEL is a marker of the luminal ER in the embryo. Reference: Lee et al., J Cell Biol. 2016 Sep 12;214(6):665-76.

zzyIs139 [his-72p::PH(PLC1delta1)::mCherry::pie-1 3' UTR + unc-119(+)] II. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. The membrane-specific PH(PLC1delta1) domain, labeled with mCherry, is expressed in all cell membranes. Derived by crossing parental strains carrying unc-119(ed3) and unc-119(tm4063). Unknown if either unc-119 mutation is still present in background. Reference: Cao J, et al. Nat Commun. 2020 Dec 7;11(1):6254. doi: 10.1038/s41467-020-19863-x. PMID: 33288755.

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a West Mains allotment public vegetable garden near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 3, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 3, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 2 plot 43) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from a flower bed soil sample in the botanic gardens in Chungcheng, Taipei, Taiwan, September 29, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost from Jenny Pettifor's garden in the Paview neighborhood in Johannesburg, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): alpha. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): gamma. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Reference: Dolgin ES, et al. Heredity (Edinb). 2008 Mar;100(3):304-15. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost from the Olive Mushroom Farms near the town of Limuru, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis briggsae wild isolate. Isolated from compost from Jenny Pettifor's garden in the Paview neighborhood in Johannesburg, South Africa, on May 5, 2006. Landscape: Urban_garden. Isolated from a compost sample from a private garden in Johannesburg, South Africa, March-April 06 by E. Dolgin. Same compost sample as ED3078-3089. WBPaper00035666. GPS: -26.200001 28.000000, Johannesburg, South Africa. Substrate: compost_heap. Sampled_by: Elie Dolgin WBPerson12345. 2006. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis briggsae wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis briggsae wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).