Search Strains

Y106G6H.14. Homozygous. Outer Left Sequence: CAGCATCCGAGTCTGACAAA. Outer Right Sequence: GACCGTCTTCGTCCATCATT. Inner Left Sequence: TTCAGCATACTCTTCTTCATTCAC. Inner Right Sequence: GCGGACCGTTGACTTTCTAT. Inner Primer PCR Length: 1296 bp. Deletion Size: 333 bp. Deletion left flank: TCAACAACGTATCCACTGCTGGCGCGTGTC. Deletion right flank: TAAAAACTGTAAAACCATGTGAATTAATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49C5.4. Homozygous. Outer Left Sequence: ATGCCCCGACCCTATAAACT. Outer Right Sequence: AGTCCCCTAGGTGGCTTGAT. Inner Left Sequence: GGTTTTGCACGGTTAAGAGC. Inner Right Sequence: TCATCAATCGCCTTCTTTTC. Inner Primer PCR Length: 1154 bp. Deletion Size: 661 bp. Deletion left flank: CACAAGTTATGAAAAATTCCAGAAAAAGTA. Deletion right flank: TTAATTTTCAGAGATACATCCTACGCCGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49D10.10. Homozygous. Outer Left Sequence: TTTGAAATCCACACTTGGCA. Outer Right Sequence: TTTTGGCGGGAGAGAATAAA. Inner Left Sequence: AGCTCCGCAAATGACAATTC. Inner Right Sequence: TTCTCCGTTTCAAGATTTAGCA. Inner Primer PCR Length: 1256 bp. Deletion Size: 248 bp. Deletion left flank: TCAGTAGGATAATCAGATGTGATCTGAAAA. Deletion right flank: GAGCAGGTTTAATTTCCACAAATGCATCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y18D10A.12, Y18D10A.23. Homozygous. Outer Left Sequence: ACCACGACTGGGAAGTTCAG. Outer Right Sequence: GCCTAACATCTGCCTTCTCG. Inner Left Sequence: ACTGGATTCTAGGCCCACG. Inner Right Sequence: GTTGCTCCATGCTACGTGAA. Inner Primer PCR Length: 1318 bp. Deletion Size: 719 bp. Deletion left flank: TTCTTCCGCCAACCCATACCTCGGCTGTTC. Deletion right flank: AATGCTCCGCAACAATGCAACGATCCACCC. Insertion Sequence: GCTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15D4.8. Homozygous. Outer Left Sequence: TTTTCGAAGCCTGTTAGCGT. Outer Right Sequence: TTTAAGTTTCCACAGGCGCT. Inner Left Sequence: AAAGTCCTGAAAAAGAAGCAGC. Inner Right Sequence: TTGAAAACAACGGTCTCGAA. Inner Primer PCR Length: 1201 bp. Deletion Size: 548 bp. Deletion left flank: CCTAAATTTGATGAATGAGTGTGGATCCGA. Deletion right flank: CCTATAGGCATCATCCATCAAAACCCCACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03B8.5. Homozygous. Outer Left Sequence: TACGTCATGTCGAGACTGGG. Outer Right Sequence: GAAAAATTCCCCACCGATTT. Inner Left Sequence: TGCTCAAGAATGAAAGCACG. Inner Right Sequence: TATTCCCCTCGATTTTTCGT. Inner Primer PCR Length: 1212 bp. Deletion Size: 785 bp. Deletion left flank: AGCCATTAATTCGTATGAATCTTGTTGTCT. Deletion right flank: GCGTAGGAAAAGAGTAGAATAATAGCTCCA. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16D3.7. Homozygous. Outer Left Sequence: GGATAAGTACGGGCAACGAA. Outer Right Sequence: AATGCGGAACGTTTGAACTC. Inner Left Sequence: TGGAGAACAATTACCCCCTG. Inner Right Sequence: AGATGATGGGATTGAGCATTG. Inner Primer PCR Length: 1119 bp. Deletion Size: 410 bp. Deletion left flank: ATTGTCACGAAAACAAAAGTAATATCAGTG. Deletion right flank: GAAAGACAAACGGGATGGTGGAGCATCAGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22C8.2. Homozygous. Outer Left Sequence: TCCATTGCATTTTGGAAACA. Outer Right Sequence: AGAGGAAAAAGAGGCGAAGG. Inner Left Sequence: TATCCCCATTTTGCATTTGG. Inner Right Sequence: GCCTGCACCATTTTCAGATT. Inner Primer PCR Length: 1114 bp. Deletion Size: 377 bp. Deletion left flank: AATCTTGATAATGCAATATACAGGACGTCA. Deletion right flank: GCTGCTCTTAAATGCCGAGAAAACTTATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27F2.1. Homozygous. Outer Left Sequence: ACGAGATCCTTGGTTTGGTG. Outer Right Sequence: TATCATCGTCCATTGCTCCA. Inner Left Sequence: GGACCAGTTTTCGACCAAGA. Inner Right Sequence: TCGAAGAAGGAACTGAAACCT. Inner Primer PCR Length: 1179 bp. Deletion Size: 716 bp. Deletion left flank: CCACCGCCGTACGGAAAACGGACCAGTTTT. Deletion right flank: TCTCCAACAGACTCATATTAATGAAAACTT. Insertion Sequence: TCGACCAAGAGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58B3.1. Homozygous. Outer Left Sequence: TGTTCACAATTGCGGTTTGT. Outer Right Sequence: GGGGCCCTTATGATCACTTT. Inner Left Sequence: CGCAAGAAGTTGCATGTTGA. Inner Right Sequence: TGGAATAATCAGATCATAAGGATGA. Inner Primer PCR Length: 1175 bp. Deletion Size: 601 bp. Deletion left flank: TATCTGCTTTTTGAAATGTAAAGCCATTTT. Deletion right flank: CTGGCCAAGCGAGACGTTCAATGTCAAGCC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK829.6. Homozygous. [NOTE: it has been reported that ok3107 disrupts the native locus, this strain appears to also carry at least a partial duplication of the tgt-1 locus.] Outer Left Sequence: GACATCCTACCGTTTCCTGG. Outer Right Sequence: CTCCTTTGCAACACGTACCA. Inner Left Sequence: TACGGTAGGCCCGATAATGA. Inner Right Sequence: CTTGGACATCGTCCCGGT. Inner Primer PCR Length: 1172 bp. Deletion Size: 684 bp. Deletion left flank: AAAAAAATTGTGTTCGAACGTTATTTTTAT. Deletion right flank: GTTGTCAATACATGAATTACATGATCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M02D8.4. Homozygous. Outer Left Sequence: TGGATCTTGGTTCTTTTGCC. Outer Right Sequence: AAACCCATTGCGATTCAGAG. Inner Left Sequence: CTCAGATGGGAACTGCTCGT. Inner Right Sequence: GCATTTGTTCTTTGTTGCGA. Inner Primer PCR Length: 1250 bp. Deletion Size: 375 bp. Deletion left flank: TCCGTGTTGAAAGCTGATCGGAGAACAAAC. Deletion right flank: AGGTTCTTGATACCTTCCTTAAAACATATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11G11.1. Homozygous. Outer Left Sequence: CGAATCATCATGAAAAGGCA. Outer Right Sequence: CATTTCCCACGCTTGAGTCT. Inner Left Sequence: GCGCAGTGGGAAGAGTAAAT. Inner Right Sequence: CCTTCTGCCGCAATTTTACA. Inner Primer PCR Length: 1208 bp. Deletion Size: 482 bp. Deletion left flank: TCAGATGTTTTTTTAGTTGTCATTGGCTTC. Deletion right flank: TGATCCAGCTCTTCTCGAAGAATTCCCACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 [NOTE: (06/03/2021) A user reported the original stock of RB2288 received by the CGC was heterozygous. A homozygous line was isolated and verified by PCR.]

Y47D3A.11. Homozygous. Outer Left Sequence: TTCCAGGTCAAAGAGCACCT. Outer Right Sequence: CCTTTGTAGCTGGCAAGTCC. Inner Left Sequence: CATCCAGGCTAAACTCCGTC. Inner Right Sequence: CAAAAGTACGCAGAAACCGA. Inner Primer PCR Length: 1206 bp. Deletion Size: 414 bp. Deletion left flank: GAGTTGTGGGTATCAGGTTCCGGATCATAC. Deletion right flank: TTTTCATTGGAACACTGTTTTACGGACTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54G2A.17. Homozygous. Outer Left Sequence: CCAAAATGGCTTGTGAGGAT. Outer Right Sequence: ATTCCAGAATCAATCGACGG. Inner Left Sequence: ATCTGACCGGCTTGTCAATG. Inner Right Sequence: ATGAACGGACAAGACTCGCT. Inner Primer PCR Length: 1165 bp. Deletion Size: 235 bp. Deletion left flank: AAAACGCAAGATAATCGCATTGTATACTCA. Deletion right flank: TGAATTCAAAGCAAAATCGCCCATAATTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK632.9 Homozygous. Outer Left Sequence: cgaacatttcgtcatctcca. Outer Right Sequence: cgtctgctgttgattcgcta. Inner Left Sequence: ccaataaatcctagcggacg. Inner Right Sequence: aaagaaatctctacgccacaca. Inner Primer PCR Length: 1179. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09F10.1 Homozygous. Outer Left Sequence: agcgccaccgtatttaatga. Outer Right Sequence: gttcgggaaactgggatttt. Inner Left Sequence: ccgtgtaaggctgttgatga. Inner Right Sequence: gtatttgcaagaccgcagc. Inner Primer PCR Length: 1290. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B9.1 Homozygous. Outer Left Sequence: agagcatcggcttcagtgtt. Outer Right Sequence: aggatatcaccgacgtgagc. Inner Left Sequence: gggagcgtcacctaaaatga. Inner Right Sequence: ggaatgagaatcgggaatca. Inner Primer PCR Length: 1247. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y18D10A.12 Homozygous. Outer Left Sequence: accacgactgggaagttcag. Outer Right Sequence: gcctaacatctgccttctcg. Inner Left Sequence: actggattctaggcccacg. Inner Right Sequence: gttgctccatgctacgtgaa. Inner Primer PCR Length: 1317. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y18D10A.12 Homozygous. Outer Left Sequence: accacgactgggaagttcag. Outer Right Sequence: gcctaacatctgccttctcg. Inner Left Sequence: actggattctaggcccacg. Inner Right Sequence: gttgctccatgctacgtgaa. Inner Primer PCR Length: 1317. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32E10.2 Homozygous. Outer Left Sequence: caattaaaatgccagtgcga. Outer Right Sequence: aggtacactgcctggtggtc. Inner Left Sequence: tgtgcacgtctattcgattca. Inner Right Sequence: tttaggatgcattatggggc. Inner Primer PCR Length: 1127. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58A6.11 Homozygous. Outer Left Sequence: tgtggctggtctgggttaat. Outer Right Sequence: ttttgcaccactgctttgag. Inner Left Sequence: aagggagaagaaaacccgac. Inner Right Sequence: atgttcaatccgtgctgtca. Inner Primer PCR Length: 1200. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20D1.1 Homozygous. Outer Left Sequence: tgcacaactcggaaatgaaa. Outer Right Sequence: aatccaaagcttatcgcgtg. Inner Left Sequence: gcttaagtgagaggaggggg. Inner Right Sequence: gcaattctcaacggttttctc. Inner Primer PCR Length: 1207. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5A.1 Homozygous. Outer Left Sequence: cgctttctcctgtaactgcc. Outer Right Sequence: cgtcctgctccaacacctat. Inner Left Sequence: cgtcgtcttcttatcctgcaa. Inner Right Sequence: atggaagagcaaaagccaaa. Inner Primer PCR Length: 1224. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C29F3.5 Homozygous. Outer Left Sequence: cgttcaactcaccagatcca. Outer Right Sequence: ttcgcgccaagtctaatttt. Inner Left Sequence: ctgcccagtcaaaatcacatt. Inner Right Sequence: aggagtgatggaccaattttt. Inner Primer PCR Length: 1298. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03G8.6 Homozygous. Outer Left Sequence: tgacatacgactcgacccaa. Outer Right Sequence: cggttttcaattgcgttttt. Inner Left Sequence: cggtccctagtaagctccaa. Inner Right Sequence: tgttgattttgcaaccgaaa. Inner Primer PCR Length: 1289. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40B5.1 Homozygous. Outer Left Sequence: taaatttcgagagccggatg. Outer Right Sequence: acgctttgtgcaagagtgtg. Inner Left Sequence: atggaggataacgcaaggaa. Inner Right Sequence: gaaagaggtgagcctggaga. Inner Primer PCR Length: 1192. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40B5.1 Homozygous. Outer Left Sequence: taaatttcgagagccggatg. Outer Right Sequence: acgctttgtgcaagagtgtg. Inner Left Sequence: atggaggataacgcaaggaa. Inner Right Sequence: gaaagaggtgagcctggaga. Inner Primer PCR Length: 1192. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y42H9AR.1 Homozygous. Outer Left Sequence: tcagtaaatcgcaggcagtg. Outer Right Sequence: gttggtgctgaagttgcaga. Inner Left Sequence: ttgtgccatctcaaaattgg. Inner Right Sequence: cgtaggatacgacggtggag. Inner Primer PCR Length: 1166. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27A8.1 Homozygous. Outer Left Sequence: atgctaatccggcacttcac. Outer Right Sequence: atctttattgcgttggtcgg. Inner Left Sequence: aaagaaggagaagtctcgacca. Inner Right Sequence: atgccccctaattttatgcc. Inner Primer PCR Length: 1177. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50C10.7 Homozygous. Outer Left Sequence: tcgacctgtcaaacatcgaa. Outer Right Sequence: cgcatttgtgaacctgtttg. Inner Left Sequence: aaatcctcgtcgataacttttga . Inner Right Sequence: gcacacatatgggtctgcttt. Inner Primer PCR Length: 1212. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13C5.5 Homozygous. Outer Left Sequence: gcgctatggttcttgaaagc. Outer Right Sequence: ccggtttgcaaggtttagtc. Inner Left Sequence: ttgtaacaaaaattgccccc. Inner Right Sequence: gatttgaatggcgatcttgag. Inner Primer PCR Length: 1279. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K05F1.6 Homozygous. Outer Left Sequence: atcaatgctcggagtgttcc. Outer Right Sequence: tccggtagtggcttctcact. Inner Left Sequence: tgtgcatggaaatcacaggt. Inner Right Sequence: ttctggtaatacgaacaccaaca. Inner Primer PCR Length: 1188. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y74C9A.5 Homozygous. Outer Left Sequence: cgaatccttaaatcctggca. Outer Right Sequence: aattctgccaactccaatgc. Inner Left Sequence: gtggatagcaagctgccagt. Inner Right Sequence: gccgtcggaataatgtcaat. Inner Primer PCR Length: 1202. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C29F3.5. Homozygous. Outer Left Sequence: CGTTCAACTCACCAGATCCA. Outer Right Sequence: TTCGCGCCAAGTCTAATTTT. Inner Left Sequence: CTGCCCAGTCAAAATCACATT. Inner Right Sequence: AGGAGTGATGGACCAATTTTT. Inner Primer PCR Length: 1299 bp. Deletion Size: 367 bp. Deletion left flank: GTCAGCGGCCTTTAAGATTTCTAGCATTTG. Deletion right flank: TTGTCATTGGAGACACCGTTTTGCCAGACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F02D10.7. Homozygous. Outer Left Sequence: ACGATGGATGCATGATGTGT. Outer Right Sequence: TCTCTTCCACGATTGCTGTG. Inner Left Sequence: TGTTTTACGGAAGGATTTGAAAG. Inner Right Sequence: CAATTGGGCTCACAAGACG. Inner Primer PCR Length: 1299 bp. Deletion Size: 487 bp. Deletion left flank: CACAATCAAGGAGCTCCTTTGTCATGACGA. Deletion right flank: TATGTAACAGACATTTTTATGGATACTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D2092.5. Homozygous. Outer Left Sequence: TGGCAGAATGTTGATGTGGT. Outer Right Sequence: TGGTGATAAAAAGAACGGGC. Inner Left Sequence: CAGAAGCAGTCTGAAACGGA. Inner Right Sequence: AACGAAAGGACGAGCGAATA. Inner Primer PCR Length: 1264 bp. Deletion Size: 972 bp. Deletion left flank: TGAACTCGTCGCTCCAATGATTTGATAGTG. Deletion right flank: CTGTTTCTGTTGTTTTTGTGAATTATTATT. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

PDB1.1. Homozygous. Outer Left Sequence: TGTGTTCGTTTCAGTCTCGC. Outer Right Sequence: ATGAAAACCAAAATGCGCTC. Inner Left Sequence: ACGGAATATGCTCCCTGATG. Inner Right Sequence: GCCCACAAAGAAGATATGCAA. Inner Primer PCR Length: 1114 bp. Deletion Size: 343 bp. Deletion left flank: TTCGCTGAAATATCATTCATTTAGAATGTA. Deletion right flank: GATGTTACCGTAAACGCGCTATCAGAATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73E7A.7. Homozygous. Outer Left Sequence: CTCTGTCCCCCATTTTCTCA. Outer Right Sequence: TTCCATATTCGGCGATCTTC. Inner Left Sequence: AGAACCCTCCGAAAAATCGT. Inner Right Sequence: CGGAATCAGTGCACTAACAAA. Inner Primer PCR Length: 1315 bp. Deletion Size: 496 bp. Deletion left flank: TTTTTTTCAAAAATCAATAAAAGTCATCGA. Deletion right flank: AATCATTTTATATCGTGCAATTTGTGTCGG. Insertion Sequence: AGTCATCGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F31D4.6. Homozygous. Outer Left Sequence: GGACTAACGGTTCGGACAAA. Outer Right Sequence: TTTCTCCACTGGCGCTATTC. Inner Left Sequence: CAATGGGCTCAAATGAACAA. Inner Right Sequence: TGAGTCGGGATTCCTTCTTT. Inner Primer PCR Length: 1248 bp. Deletion Size: 666 bp. Deletion left flank: CTTAATGTGTAATAGAAAAAGTGTAATATT. Deletion right flank: ACATGTTAGGGCGTGGAAGACAAATTGGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.14. Homozygous. Outer Left Sequence: CAGCATCCGAGTCTGACAAA. Outer Right Sequence: GACCGTCTTCGTCCATCATT. Inner Left Sequence: TTCAGCATACTCTTCTTCATTCAC. Inner Right Sequence: GCGGACCGTTGACTTTCTAT. Inner Primer PCR Length: 1296 bp. Deletion Size: 381 bp. Deletion left flank: GCTGTAAGTATTCACCATAATTAGCTGGAA. Deletion right flank: CCGTTTATTAGCTATTTGACAGAGAAATTT. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03D8.6. Homozygous. Outer Left Sequence: TTTTTCGACGATTGAGCCTT. Outer Right Sequence: TACGCGCAGAAGAATTTGTG. Inner Left Sequence: CAGTCATTCTATCAATAACCCATTG. Inner Right Sequence: CGAAAATTGGAGGGTAAGCA. Inner Primer PCR Length: 1214 bp. Deletion Size: 689 bp. Deletion left flank: CTCCGTGATAGAAAAGTTGAACTGGGTTTG. Deletion right flank: AATAAACACACAGCAATTAGCTGAAAAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09A8.3. Homozygous. Outer Left Sequence: CAAAGCAACACCAAAGCAAA. Outer Right Sequence: AAAAGACGTGGCGAAAGCTA. Inner Left Sequence: GCCATTGAGACGAAGGACTG. Inner Right Sequence: GCGTCTCGTCTTCCAAACAT. Inner Primer PCR Length: 1120 bp. Deletion Size: 643 bp. Deletion left flank: GCCATGCATTGGTTTTTGGATCGAATGCTT. Deletion right flank: CTCGTTGTCCGTAAGCTGAAGGCTAAGCAC. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13H8.9. Homozygous. Outer Left Sequence: TCTCAATCGGTGATGATGGA. Outer Right Sequence: AAGGCTGCTGATGCAATTCT. Inner Left Sequence: TCTTCTTAAGACGGGGAGCA. Inner Right Sequence: GAAGCAAGAAGTCATCTCGGA. Inner Primer PCR Length: 1198 bp. Deletion Size: 754 bp. Deletion left flank: CCACACTTGATGTATTTGGAAGTCTCTGGG. Deletion right flank: GAAGTTTTGAAACTTTCTTAGCATTTCTTA. Insertion Sequence: TGCTCGATATTTGTAGTGATAATATGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23G5.6. Homozygous. Outer Left Sequence: AGAAATGGATGGAAGCAACG. Outer Right Sequence: TAGGTGAGGGAAGTGCTGCT. Inner Left Sequence: AAACATTGCCCTGCAAAAAG. Inner Right Sequence: GCGATGCGATTTAGAGCAAT. Inner Primer PCR Length: 1281 bp. Deletion Size: 891 bp. Deletion left flank: ACGTGATAAAAAGGAACAAAATGGATATGG. Deletion right flank: GATGACAAAAATATTCTACATGAGCAAAAT. Insertion Sequence: ATATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54E5B.4. Homozygous. Outer Left Sequence: AAGTTGTCGGAATTGGTTGG. Outer Right Sequence: TTGCGATTCGAAGAGAGCTT. Inner Left Sequence: CATTGTTCAATATGCACCCAA. Inner Right Sequence: TGGCCACAAAGAAGAAAAGG. Inner Primer PCR Length: 1138 bp. Deletion Size: 551 bp. Deletion left flank: TAAACACAATTTTTTTTCAGACGACAGTGT. Deletion right flank: GTGGGCGGCAAACGATTTTCCCGGAAAAAC. Insertion Sequence: ACAGTACCCACATTTGATAATATTTCGATACAAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04A11.4. Homozygous. Outer Left Sequence: GGGAGATCAAATTTCGGTGA. Outer Right Sequence: CGATTGGCGGAAATTCTAAA. Inner Left Sequence: TCCAGATTCAAAAGAGACGTTG. Inner Right Sequence: CCACTGAGCGTAGTCCACCT. Inner Primer PCR Length: 1253 bp. Deletion Size: 989 bp. Deletion left flank: CTTGATGACGTGGGTGTTCCTATACAAAAA. Deletion right flank: TTTGTATAAAAATAGAGAAAAATATCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25E5.7. Homozygous. Outer Left Sequence: TTCGGCAATATGCCCTTAAC. Outer Right Sequence: CGCGGCTGAAGACTTTAGTT. Inner Left Sequence: CCTTTCCTCCAACGAAGAATC. Inner Right Sequence: TGACATTGCATACCAGGAGAA. Inner Primer PCR Length: 1222 bp. Deletion Size: 631 bp. Deletion left flank: TTTCAGTATTACGTTCAAAAAGATGGGAAA. Deletion right flank: GAACATGAACTGCAATGCGAATCCACAGAA. Insertion Sequence: AAAAAAACATTTTGATTAATTTCAGAATTTTGATAAATTTCAAAACATTTGATTAATTT CAGTATGACTCCGGAGGTAGTGCAATAAGCAACGTTTCCGGACAAAATACCGTTCTTGG AGTGTATGTAACAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49C3. Homozygous. Outer Left Sequence: TCCCTTAAAACGTGCAATGA. Outer Right Sequence: CCAAATTCCTCCTGTTTGGA. Inner Left Sequence: TCAATTCAGTGCATGCTTCA. Inner Right Sequence: CTTCTTCAGCAAACGAAGCC. Inner Primer PCR Length: 1310 bp. Deletion Size: 281 bp. Deletion left flank: AAAAAAGAAAAAGAAAGTTCGAAAATGTGT. Deletion right flank: AAAGAGTAATTTTTTCGAAATTTGAAATCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK381.5. Homozygous. Outer Left Sequence: TCGGGATACCCAGTAAGCAG. Outer Right Sequence: CCTCCAATTGTGCTTCTTCG. Inner Left Sequence: AATAGTCTCCCAGGGCCAAG. Inner Right Sequence: CACGTTCACAATTGTAATTCTCGT. Inner Primer PCR Length: 1264 bp. Deletion Size: 649 bp. Deletion left flank: TCCATAATAACAAGAGTTGAAAAAGCAAAT. Deletion right flank: TTTCGGGTTTAAATTGTATACCTCTGCATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807