More Fields
Strain Species Genotype
RB2283 C. elegans lys-4(ok3106) IV. Show Description
F58B3.1. Homozygous. Outer Left Sequence: TGTTCACAATTGCGGTTTGT. Outer Right Sequence: GGGGCCCTTATGATCACTTT. Inner Left Sequence: CGCAAGAAGTTGCATGTTGA. Inner Right Sequence: TGGAATAATCAGATCATAAGGATGA. Inner Primer PCR Length: 1175 bp. Deletion Size: 601 bp. Deletion left flank: TATCTGCTTTTTGAAATGTAAAGCCATTTT. Deletion right flank: CTGGCCAAGCGAGACGTTCAATGTCAAGCC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
CB6785 C. elegans unc-119(ed3) III; eEx650. Show Description
eEx650 [ilys-4p::GFP + unc-119(+)]. Transcriptional reporter for ilys-4. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
PHX700 C. elegans ilys-4(syb700) IV. Show Description
Complete knock out of gene. Increased L1 arrest sleep/quiescence. Reference: Konietzka et al. 2019. Current Biology (accepted).
VC3885 C. elegans ilys-4(gk3827[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 IV; +/nT1 V. Show Description
Homozygous lethal or sterile deletion balanced by nT1. Deletion of 692 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous nT1 is non-GFP vulvaless hermaphrodite that bags. Left flanking sequence: CTTAATTTTTTAGTGGAAGACGATCATCCA; Right flanking sequence: GGGAACAATTGGATATTGGAAAAGAGTTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.