| WM140 |
drh-3(tm1217) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); him-8(e1489) IV. |
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP Sterile homozygotes. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. May have him-8(e1489) in background, but unsure. |
| WM206 |
drh-3(ne4253) I. |
Mutator. Dominant RNA-i deficient. Temperature sensitive sterile. Maintain at 15-20 C. ne4253 is a C-to-T transition at position 3896 of the genomic DNA with respect to the +1 position of the ATG creating a T834M missense mutation. Reference: Gu, et al. 2009 Mol Cell 36:234-44. |
| WM216 |
avr-14(ad1302) drh-3(tm1217) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); avr-15(ad1051) glc-1(pk54)) V. |
Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP drh-3 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34. |
| WM230 |
drh-3(ne3197) I. |
Mutator. Dominant RNAi-deficient. Temperature-sensitive sterile. Maintain at 15-20C. ne3197 is a G840D missense mutation. Reference: Gu W, et al. Mol Cell. 2009 Oct 23;36(2):231-44. |
| WM231 |
drh-3(ne4254) I. |
Mutator. Dominant RNAi-deficient. Temperature-sensitive sterile. Maintain at 15-20C. ne4254 is a G802E missense mutation. Reference: Gu W, et al. Mol Cell. 2009 Oct 23;36(2):231-44. |
| ZT2 |
drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable. |