| FX19119 |
atm-1(tm5027) C46H11.6(tm7811) I; tmIn20 II; xpc-1(tm3886) F01D4.9(tm7812) IV; aqp-4(tm7813) V. |
tmIn20 is an inversion between F46C5.9 and C08H9.13 in LG II. Inversion strain obtained by Next-generation sequencing. |
| FX19120 |
atm-1(tm5027) Y47G6A.28(tm7889) nepr-1(tm7890) I; C18H9.6(tm7891) II; xpc-1(tm3886) tmIn21 IV; srh-54(tm7892) V. |
tmIn21 is an inversion between pck-3 and R09H10.5 in LG IV. Inversion strain obtained by Next-generation sequencing. |
| FX19141 |
atm-1(tm5027) C37A2.6(tm8115) I; Y48A6B.8(tm8116) III; xpc-1(tm3886) IV; tmIn22 V. |
tmIn22 is an inversion between W02G9.9 and 21ur-15544 in LG V. Inversion strain obtained by Next-generation sequencing. |
| VC381 |
atm-1(gk186) I. |
Y48G1BL.2. Superficially wild type. [NOTE: According to WormBase, gk186 is a 548 bp deletion. Left external: gtcgggttttgatgcacttt Right external: atctttccatcgtttccacg Left internal: aaattcgatttttcgcgatg Right internal: caattgacgcaatttgcact] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |