Variation Information: y356
| Name | y356 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | II:-6.23 +/- 0.000 cM |
| Genomic position | II: 3673494..3673494 |
| Protein change | Substitution |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| TY3579 | sea-1(y356) II. | C. elegans | Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains. |