Laboratory Information
| Name | TY View on WormBase |
|---|---|
| Allele designation | y |
| Head | Barbara J. Meyer |
| Institution | University of California-Berkeley, Berkeley, CA |
| Address | HHMI/ UC Berkeley Dept. of MCB 16 Barker Hall Berkeley 94720-3204 United States |
| Website | http://mcb.berkeley.edu/labs/meyer/ |
| Gene classes | ash box capg mix rnp scc sdc sea sex uxt xol dox |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| JT10189 | daf-14(m77) IV; scd-2(sa935) V. | C. elegans | Daf-c strongly but not completely suppressed; some dauers visible at 25C. sa935 alone is moderate Daf-d (dauer defective) in plate starvation assays, and resistant to exogenous dauer pheromone. sa935 confers strong suppression of daf-8 and daf-14, weak suppression of daf-1, -4, -7. scd-2(sa935) single mutant looks WT. snb-1(md247) hypomorph is an excellent balancer for scd-2; snb-1 is immediately neighboring. Maintain at 15 degrees. |
| JT10783 | scd-2(sa935) V; lin-15B&lin-15A(n765) X; saEx472. | C. elegans | saEx472 [(pTJ1369) scd-2(+) + lin-15(+)]. Pick wildtype worms, maintain at 25 degrees (non-transgenics will be Muv). |
| KK96 | unc-4(e120) mix-1(b285) sqt-1(sc13)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | mix-1(b285) is maternal effect lethal. Heterozygotes are WT and segregate WT, Unc-4 worms which are strong Egl, and paralyzed Dpy Uncs. |
| KR292 | him-1(h55) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). | C. elegans | sDp2 covers him-1 dpy-5. Pick Unc to maintain. Animals that lose the array are inviable. |
| NG41 | sex-1(gm41) X. | C. elegans | Egl. Dpy. |
| TY1077 | C25D7.12(y128) unc-76(e911)/sdc-3(y52) unc-76(e911) V; xol-1(y9) X. | C. elegans | Heterozygotes are Unc and segregate Uncs, Dpy Uncs [C25D7.12(y128) unc-76(e911) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| TY1312 | unc-42(e270) yDf9 V/nT1 [let-?(m435)] (IV;V). | C. elegans | Heterozygotes are WT and throw WT and dead eggs. yDf9 homozygotes arrest as dead eggs. |
| TY1313 | yDf11 V/nT1 [let-?(m435)] (IV;V). | C. elegans | Heterozygotes are WT and segregate WT and dead eggs. yDf11 homozygotes arrest as dead eggs. |
| TY1353 | yDf10 unc-32(e189)/unc-93(e1500) dpy-17(e164) III. | C. elegans | Heterozygotes are Unc-93 and segregate more Unc-93, yDf10 homozygotes (dead eggs) and Unc-93 Dpy-17 homozygotes (young dpy-17 larvae are easily recognizable as abnormal spindle-shaped things). Difficult to maintain and use. yDf10 apparently causes semi-sterility (a second strain constructed by the Mark Edgley at the CGC, yDf10/qC1, exhibits same sterility), and unc-93 is Egl and difficult to mate into. Some Df homozygotes are laid, but most remain inside the mother. |
| TY1388 | C25D7.12(y128)/sdc-3(y52) unc-76(e911) V. | C. elegans | Heterozygotes are WT and segregate WT, Dpys [C25D7.12(y128) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| TY1470 | yDf8 V/nT1 [unc-?(n754) let-?] (IV;V). | C. elegans | Unc strain which segregates Uncs and dead eggs. |
| TY148 | dpy-28(y1) III. | C. elegans | Temperature sensitive. 20% viable at 20C. 80% viable at 15C. XX animals are Dpy. XO animals are nearly WT. |
| TY156 | unc-30(e191) dpy-4(e1166) IV; yDp1 (IV;V;f). | C. elegans | Animals with the Dup are WT. Animals which have lost the Dup are DpyUnc. Maintain by picking WT. |
| TY1702 | unc-42(e270) yDf12 V/nT1 [unc-?(n754) let-?] (IV;V); dpy-6(e14) X. | C. elegans | Heterozygotes are DpyUnc and segregate DpyUnc and dead eggs. |
| TY1774 | yIs2 IV. | C. elegans | yIs2 [xol-1::lacZ + rol-6(su1006)] IV. Rollers. XO-specific expression of lacZ fusion. |
| TY1775 | yIs2 him-8(e1489) IV. | C. elegans | yIs2 [xol-1::laxZ + rol-6(su1006)] IV. Rollers. XO-specific expression of lacZ fusion. |
| TY1807 | xol-1(y9) X. | C. elegans | Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf). |
| TY1909 | yDp4/+ (X;A); kynu-1(e1003) unc-9(e101) X. | C. elegans | Animals heterozygous for yDp4 are Dpy non-Flu non-Unc. Animals which have lost yDp4 are FluUnc. Animals homozygous for yDp4 are dead (embryonic lethal). Low percentage of non-Dpy non-Unc progeny. These give a high percentage of Unc male self-progeny and are inferred to be yDp4 XO hermaphrodites. |
| TY1910 | yDp5 (X;A); lon-2(e678) unc-9(e101) X. | C. elegans | Lon non-Unc hermaphrodite strain. yDp5 is homozygous viable. yDp5/+ XO animals are fertile males. |
| TY1911 | yDp6 (X;A); lon-2(e678) unc-9(e101) X. | C. elegans | Lon non-Unc hermaphrodites. yDp6 is homozygous viable. yDp6/+ XO animals are fertile males. |
| TY1912 | yDp7/+ (X;A); lon-2(e678) unc-9(e101) X. | C. elegans | Animals heterozygous for yDp7 are Lon non-Unc. Animals which have lost yDp7 are LonUnc. Animals homozygous for yDp7 are Dpy and sick hermaphrodites. yDp7/+ XO males are Dpy and infertile. yDp7 attached to an autosome. |
| TY1913 | yDp8/+ (X;A); lon-2(e678) unc-9(e101) X. | C. elegans | Animals heterozygous for yDp8 are Lon non-Unc hermaphrodites. Animals which have lost yDp8 are LonUnc. Animals homozygous for yDp8 are Dpy and sick hermaphrodites. yDp8/+ XO males are Dpy and infertile. |
| TY1914 | yDp9 (X;A); lon-2(e678) unc-9(e101) X. | C. elegans | Lon non-Unc hermaphrodite strain. yDp9 is homozygous viable. yDp9/+ XO animals are fertile males. |
| TY1915 | yDp10/+ (X;A); lon-2(e678) unc-9(e101) X. | C. elegans | Animals heterozygous for yDp10 are Lon non-Unc hermaphrodites. Animals which have lost yDp10 are LonUnc. Animals homozygous for yDp10 are Dpy and sick hermaphrodites. yDp10/+ XO animals are Dpy and infertile males. |
| TY1916 | yDp11 (X;IV); lon-2(e678) unc-9(e101) X. | C. elegans | Lon non-Unc hermaphrodite strain. yDp11 is homozygous viable. yDp11/+ XO animals are fertile males. |
| TY1917 | lon-2(e678) unc-9(e101) X; yDp12 (X;f). | C. elegans | Free duplication. Animals with yDp12 are Lon non-Unc hermaphrodites. Animals which have lost yDp12 are LonUnc. yDp12/+ XO animals are fertile males. |
| TY1936 | dpy-30(y228) V/nT1 [unc-?(n754) let-?] (IV;V). | C. elegans | Heterozygotes are Unc and segregate Unc, dead eggs and temperature sensitive Dpys. At 15C the y228 homozygotes (derived from heterozygous mothers) are WT and most of their progeny are inviable, dying as arrested embryos or as necrotic Uncoordinated and Constipated L1 larvae; a small number of animals survive and develop into Dpy, Egl adults with a protruding vulva. At 25C the y228 homozygotes (derived from a heterozygous mother) are Dpy and Egl and have a protruding vulva; progeny from these animals are inviable and die as embryos or L1 larvae. See also WBPaper00002302. |
| TY2025 | yDp14 (X;I); unc-2(e55) X. | C. elegans | non-Unc hermaphrodite strain. yDp14/+; unc-2 males are 60% inviable. yDp14/yDp14; unc-2 males are dead. |
| TY2071 | him-8(e1489) IV; dpy-3(e27) unc-2(e55) X; yDp16 (X;f). | C. elegans | non-Unc, somewhat Dpy hermaphrodites. Gives DpyUncs when yDp16 is lost. |
| TY2137 | meDf6 X; yDp13 (X;f). | C. elegans | meDf6; yDp13 is WT hermaphrodite which is Him. 27% of self-progeny are WT males. yDp13 recombines with X, but such recombination is greatly reduced in an meDf6 background. Maintain by picking L4 hermaphrodites and checking to make sure they give lots of dead eggs and lots of males. [yDp13 XO males with an intact X chromosome are >90% inviable.] |
| TY2138 | meDf6 X; yDp15 (X;f). | C. elegans | meDf6; yDp15 is WT hermaphrodite which is Him. 23% of self-progeny are WT males. yDp15 recombines with X, but such recombination is greatly reduced in an meDf6 background. Maintain strain by picking L4 hermaphrodites and making sure they give lots of dead eggs and lots of males. [yDp15 XO males with an intact X chromosome are >90% inviable.] |
| TY2139 | mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf13 unc-1(e1598n1201) dpy-3(e27) X. | C. elegans | Heterozygotes are WT hermphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; yDf13 unc-1 dpy-3), WT males and Dpy males. |
| TY2173 | mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf17 X. | C. elegans | The hermaphrodites are variable in phenotype, but most are Dpyish (small) and sick. Pick these hermaphrodites to maintain the strain, since healthier animals may have picked up a suppressor mutation or gone polyploid, etc. Strain gives WT males. |
| TY2175 | mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf17/unc-1(e1598n1201) dpy-3(e27) X. | C. elegans | WT hermaphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; unc-1 dpy-3), Unc hermaphrodites (yDp14; unc-1 dpy-3), DpyTra hermaphrodites (mnDp66/yDp14; yDf17), WT males, Unc males, and Dpy males. There are 2 types of WT hermaphrodites in this strain which are indistinguishable unless you score their offspring: mnDp66/yDp14; him-8; yDf17/unc-1 dpy-3 animals will have many WT males progeny; but mnDp66/yDp14; him-8; unc-1 dpy-3 animals will have primarily dpy male progeny [mnDp66/yDp14; unc-1 dpy-3 XO animals are mostly dead, but there are some escapers of lethality]. Maintain by picking L4 WT hermaphrodites and checking for correct segregation of progeny. |
| TY2202 | yDp14 (X;I); him-8(e1489) IV; yDf20 X. | C. elegans | |
| TY2384 | sex-1(y263) X. | C. elegans | Dpy. Egl. |
| TY2431 | him-8(e1489) IV; yIs34 V. | C. elegans | yIs34 [(pMN15.1) xol-1::GFP + rol-6(su1006)]. Pick Rollers. xol-1::GFP translational fusion with sXO-specific expression. Strain gives some non-Rollers, which represent silenced arrays. |
| TY2438 | yIs33 III. | C. elegans | yIs33 [xol-1::lacZ + rol-6(su1006)]. Rollers. XO-specific expression of lacZ fusion. |
| TY2439 | yIs33 III; him-8(e1489) IV. | C. elegans | yIs33 [xol-1::lacZ + rol-6(su1006)]. Rollers. XO-specific expression of lacZ fusion. Not all animals Roll. |
| TY2685 | fox-1(y303) X. | C. elegans | |
| TY2782 | fox-1(y303) dpy-6(e14) X. | C. elegans | |
| TY2788 | unc-4(e120) II; yDf19/yDf20 X. | C. elegans | yDf20 previously known as y288. Internal deletion. Takes out dpy-3 and lin-32. Heterozygotes are Unc. |
| TY3553 | scd-2(y386) V. | C. elegans | Variably scrawny, Sma, starved-looking, sluggish. |
| TY3558 | unc-119(ed3) ruIs32 III; ojIs1. | C. elegans | ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Histone and tubulin GFP. |
| TY3579 | sea-1(y356) II. | C. elegans | Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains. |
| TY3581 | daf-8(e1393) I; scd-2(y386) V. | C. elegans | Egl. Not temperature sensitive -- can be grown at any temperature. |
| TY3753 | daf-7(e1372) III; cuIs2 IV. | C. elegans | cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Weak Rollers. Dauer constitutive at higher temperatures. Maintain at 15C. |
| TY3837 | dpy-28(y402)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. | C. elegans | qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. |
| TY3856 | cuIs5 I. | C. elegans | cuIs5 [myo-2c:: GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx. |
| TY3862 | daf-7(e1372) III; cuIs5. | C. elegans | cuIs5 [myo-2c:: GFP + rol-6(su1006)]. Daf-c. Maintain at 15C. Rollers. GFP+ in pharynx. Reference: Reiner DJ, et al. (2008) Current Biology 18(15):1101-9. |
| TY3886 | cuIs5 I; daf-3(e1376) X. | C. elegans | cuIs5 [myo-2c::GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx. |
| TY3936 | dpy-21(e428) V. | C. elegans | Dpy. Throws males. Pick L4 hermaphrodites to maintain. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32. TY3936 was derived in 2002 from TY1932 ncl-1(e1865) unc-36(e251); dpy-21(e428) X N2; cloned WT progeny, let self and picked Dpy animals, cloned and selfed, looked for absence of Unc progeny. TY1932 was frozen into TY collection in 1993; built from other strains derived original CB428 stock obtained & frozen in 1983. |
| TY404 | +/szT1 [lon-2(e678)] I; lin-15B&lin-15A(n765) yDf1/szT1 X. | C. elegans | Heterozygotes are WT and segregate WT, dead eggs, and Lon males. Maintain by picking WT. |
| TY415 | unc-32(e189) dpy-28(s939) III/eT1 III; +/eT1 V. | C. elegans | WT strain which segregates WT, Unc-36, DpyUnc and dead eggs. DpyUncs give 6-10% viable progeny at 20C and less than 1% at 15C. Maintain by picking WT. |
| TY418 | dpy-21(y47) V. | C. elegans | Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y47) is a nonsense mutation predicted to terminate translation at codon 1396, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32. |
| TY4236 | him-8(e1489) IV; mIs10 V. | C. elegans | mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Him. mIs10 suppresses recombination between unc-60 and dpy-11. |
| TY4381 | dpy-28(s939)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. | C. elegans | qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP s939 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. |
| TY4851 | sup-9(n1012) II. | C. elegans | Superficially wild-type. |
| TY4852 | sup-9(n1020) II. | C. elegans | Superficially wild-type. |
| TY4986 | htp-3(y428) ccIs4251 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I,III). | C. elegans | ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, htp-3(y428) ccIs4251 homozygotes that are GFP+ in body wall muscle but not pharynx, hT2 GFP+ homozygotes, and aneuploid dead embryos. Avoid picking viable aneuploids that often appear larger and longer than wild-type. |
| TY5038 | htp-3(tm3655) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I,III). | C. elegans | Segregates WT GFP+ heterozygotes, GFP- tm3655 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Avoid picking viable aneuploids that often appear larger and longer than wild-type. |
| TY5120 | +/nT1 IV; coh-4(tm1857) coh-3(gk112) V/nT1 [qIs51] V. | C. elegans | Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos. |
| TY5121 | rec-8(ok978)/nT1 IV; coh-4(tm1857) coh-3(gk112) V/nT1 [qIs51] V. | C. elegans | Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile rec-8(ok978); coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos. |
| TY525 | him-8(e1489) IV; xol-1(y9) X. | C. elegans | Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf). |
| TY562 | +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf3/szT1 X. | C. elegans | Unc. Throws Unc, UncLon males and dead eggs. |
| TY5640 | Ppa-unc-119(y566). | Pristionchus pacificus | Pristionchus pacificus. Ppa-unc-119(y566). Reference: Lo TW, et al. Genetics. 2013 Oct;195(2):331-48. |
| TY567 | +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf2/szT1 X. | C. elegans | Unc. Throws Unc, UncLon males and dead eggs. |
| TY5684 | sdc-2(y93) X. | C. elegans | Temperature-sensitive. Maintain at 15C. Complements other sdc-2 alleles at 15C. At 20C animals are not Dpy or Tra, but there is a low penetrance of lethality, some Egl animals, and some animals will Bag after a couple days of egg-laying. y93 fails to complement other sdc-2 alleles at 25C; homozygotes are Egl,Tra and weakly Dpy at higher temperatures. Shifting embryos (prepared from non-Dpy non-Egl non-Tra gravid adults at 20C) from 20C to 25C is sufficient to alter their phenotype. Reference: Nusbaum C & Meyer BJ. Genetics. 1989 Jul;122(3):579-93. |
| TY574 | dpy-21(y59) V. | C. elegans | Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y59) is a nonsense mutation predicted to terminate translation at codon 417, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32. |
| TY5755 | xol-1(y684) X. | C. elegans | Male lethal. y684 is s a null allele caused by precise deletion of the coding sequence of xol-1. Reference: Anderson EC, et al. Dev Cell. 2019 Oct 21;51(2):192-207.e6. |
| TY578 | +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf5/szT1 X. | C. elegans | Unc. Throws Unc, UncLon males and dead eggs. |
| TY714 | +/szT1 [lon-2(e678)] I; sdc-2(y46)/szT1 X. | C. elegans | Heterozygotes are WT. |
| TY788 | lin-15B&lin-15A(n765) sup-10(n983) X. | C. elegans | Animals are Muv and Unc at 20C and 25C. At 15C the animals are Unc. Temperature sensitive Muv phenotype. See also WBPaper00001990. |
| TY824 | +/szT1 [lon-2(e678)] I; sdc-2(y74)/szT1 X. | C. elegans | Heterozygotes are WT and segregate WT, Lon males, and dead eggs. sdc-2(y74)/sdc-2(y74) is lethal, although about 3% of the animals escape the lethality. These animals are extremely Dpy, extensively masculinized, and never fertile. |
| TY832 | yDf4/dpy-11(e224) unc-76(e911) V. | C. elegans | Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT. |
| TY873 | yDf6/unc-76(e911) V. | C. elegans | Heterozygotes are WT and segregate WT, Unc, and dead eggs. Maintain by picking WT. |
| TY903 | yDf7/unc-76(e911) V. | C. elegans | Heterozygotes are WT and segregate WT, Unc and dead eggs. Maintain by picking WT. |
| TY956 | sdc-3(y132)/unc-76(e911) V. | C. elegans | Heterozygotes are WT and segregate WT, Unc and Dpy (sdc-3/sdc-3). sdc-3 homozygotes exhibit a strong maternal effect lethality->most progeny from homozygotes arrest as L1 larvae--about 14% escape the lethality and develop into Dpy, Egl hermaphrodites. |
| VT191 | +/szT1 [lon-2(e678)] I; dpy-6(e14) lin-14(n536) maDf1/szT1 X. | C. elegans | |
| VT192 | +/szT1 [lon-2(e678)] I; dpy-6(e14) lin-14(n536) maDf2/szT1 X. | C. elegans |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| y52 | Allele | substitution | |
| y180 | Allele | ||
| y101 | Allele | ||
| y1 | Allele | substitution | |
| y9 | Allele | ||
| y56 | Allele | ||
| y70 | Allele | ||
| y250 | Allele | substitution | |
| y251 | Allele | substitution | |
| WBVar00275318 | Naturally occurring | ||
| y128 | Allele | substitution | |
| y226 | Allele | ||
| y228 | Allele | ||
| y263 | Allele | substitution | splice_site |
| y303 | Allele | ||
| y386 | Allele | deletion | |
| y356 | Allele | substitution | nonsense |
| y402 | Allele | deletion | |
| y47 | Allele | substitution | nonsense |
| y428 | Allele | substitution | nonsense |
| y93 | Allele | ||
| y59 | Allele | substitution | nonsense |
| y46 | Allele | ||
| y74 | Allele | ||
| y132 | Allele | deletion | frameshift |