Laboratory Information

NameTY View on WormBase
Allele designationy
HeadBarbara J. Meyer
InstitutionUniversity of California-Berkeley, CA, USA
Address HHMI/ UC Berkeley
Dept. of MCB
16 Barker Hall
Berkeley 94720-3204
United States
Website http://mcb.berkeley.edu/labs/meyer/
Gene classes ash  box  capg  mix  rnp  scc  sdc  sea  sex  uxt  xol  dox 

Strains contributed by this laboratory

Strain Genotype Species Description
JT10189 daf-14(m77) IV; scd-2(sa935) V. C. elegans Daf-c strongly but not completely suppressed; some dauers visible at 25C. sa935 alone is moderate Daf-d (dauer defective) in plate starvation assays, and resistant to exogenous dauer pheromone. sa935 confers strong suppression of daf-8 and daf-14, weak suppression of daf-1, -4, -7. scd-2(sa935) single mutant looks WT. snb-1(md247) hypomorph is an excellent balancer for scd-2; snb-1 is immediately neighboring. Maintain at 15 degrees.
JT10783 scd-2(sa935) V; lin-15B&lin-15A(n765) X; saEx472. C. elegans saEx472 [(pTJ1369) scd-2(+) + lin-15(+)]. Pick wildtype worms, maintain at 25 degrees (non-transgenics will be Muv).
KK96 unc-4(e120) mix-1(b285) sqt-1(sc13)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans mix-1(b285) is maternal effect lethal. Heterozygotes are WT and segregate WT, Unc-4 worms which are strong Egl, and paralyzed Dpy Uncs.
KR292 him-1(h55) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). C. elegans sDp2 covers him-1 dpy-5. Pick Unc to maintain. Animals that lose the array are inviable.
NG41 sex-1(gm41) X. C. elegans Egl. Dpy.
TY1077 C25D7.12(y128) unc-76(e911)/sdc-3(y52) unc-76(e911) V; xol-1(y9) X. C. elegans Heterozygotes are Unc and segregate Uncs, Dpy Uncs [C25D7.12(y128) unc-76(e911) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
TY1312 unc-42(e270) yDf9 V/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and throw WT and dead eggs. yDf9 homozygotes arrest as dead eggs.
TY1313 yDf11 V/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs. yDf11 homozygotes arrest as dead eggs.
TY1353 yDf10 unc-32(e189)/unc-93(e1500) dpy-17(e164) III. C. elegans Heterozygotes are Unc-93 and segregate more Unc-93, yDf10 homozygotes (dead eggs) and Unc-93 Dpy-17 homozygotes (young dpy-17 larvae are easily recognizable as abnormal spindle-shaped things). Difficult to maintain and use. yDf10 apparently causes semi-sterility (a second strain constructed by the Mark Edgley at the CGC, yDf10/qC1, exhibits same sterility), and unc-93 is Egl and difficult to mate into. Some Df homozygotes are laid, but most remain inside the mother.
TY1388 C25D7.12(y128)/sdc-3(y52) unc-76(e911) V. C. elegans Heterozygotes are WT and segregate WT, Dpys [C25D7.12(y128) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
TY1470 yDf8 V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Unc strain which segregates Uncs and dead eggs.
TY148 dpy-28(y1) III. C. elegans Temperature sensitive. 20% viable at 20C. 80% viable at 15C. XX animals are Dpy. XO animals are nearly WT.
TY156 unc-30(e191) dpy-4(e1166) IV; yDp1 (IV;V;f). C. elegans Animals with the Dup are WT. Animals which have lost the Dup are DpyUnc. Maintain by picking WT.
TY1702 unc-42(e270) yDf12 V/nT1 [unc-?(n754) let-?] (IV;V); dpy-6(e14) X. C. elegans Heterozygotes are DpyUnc and segregate DpyUnc and dead eggs.
TY1774 yIs2 IV. C. elegans yIs2 [xol-1::lacZ + rol-6(su1006)] IV. Rollers. XO-specific expression of lacZ fusion.
TY1775 yIs2 him-8(e1489) IV. C. elegans yIs2 [xol-1::laxZ + rol-6(su1006)] IV. Rollers. XO-specific expression of lacZ fusion.
TY1807 xol-1(y9) X. C. elegans Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf).
TY1909 yDp4/+ (X;A); kynu-1(e1003) unc-9(e101) X. C. elegans Animals heterozygous for yDp4 are Dpy non-Flu non-Unc. Animals which have lost yDp4 are FluUnc. Animals homozygous for yDp4 are dead (embryonic lethal). Low percentage of non-Dpy non-Unc progeny. These give a high percentage of Unc male self-progeny and are inferred to be yDp4 XO hermaphrodites.
TY1910 yDp5 (X;A); lon-2(e678) unc-9(e101) X. C. elegans Lon non-Unc hermaphrodite strain. yDp5 is homozygous viable. yDp5/+ XO animals are fertile males.
TY1911 yDp6 (X;A); lon-2(e678) unc-9(e101) X. C. elegans Lon non-Unc hermaphrodites. yDp6 is homozygous viable. yDp6/+ XO animals are fertile males.
TY1912 yDp7/+ (X;A); lon-2(e678) unc-9(e101) X. C. elegans Animals heterozygous for yDp7 are Lon non-Unc. Animals which have lost yDp7 are LonUnc. Animals homozygous for yDp7 are Dpy and sick hermaphrodites. yDp7/+ XO males are Dpy and infertile. yDp7 attached to an autosome.
TY1913 yDp8/+ (X;A); lon-2(e678) unc-9(e101) X. C. elegans Animals heterozygous for yDp8 are Lon non-Unc hermaphrodites. Animals which have lost yDp8 are LonUnc. Animals homozygous for yDp8 are Dpy and sick hermaphrodites. yDp8/+ XO males are Dpy and infertile.
TY1914 yDp9 (X;A); lon-2(e678) unc-9(e101) X. C. elegans Lon non-Unc hermaphrodite strain. yDp9 is homozygous viable. yDp9/+ XO animals are fertile males.
TY1915 yDp10/+ (X;A); lon-2(e678) unc-9(e101) X. C. elegans Animals heterozygous for yDp10 are Lon non-Unc hermaphrodites. Animals which have lost yDp10 are LonUnc. Animals homozygous for yDp10 are Dpy and sick hermaphrodites. yDp10/+ XO animals are Dpy and infertile males.
TY1916 yDp11 (X;IV); lon-2(e678) unc-9(e101) X. C. elegans Lon non-Unc hermaphrodite strain. yDp11 is homozygous viable. yDp11/+ XO animals are fertile males.
TY1917 lon-2(e678) unc-9(e101) X; yDp12 (X;f). C. elegans Free duplication. Animals with yDp12 are Lon non-Unc hermaphrodites. Animals which have lost yDp12 are LonUnc. yDp12/+ XO animals are fertile males.
TY1936 dpy-30(y228) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, dead eggs and temperature sensitive Dpys. At 15C the y228 homozygotes (derived from heterozygous mothers) are WT and most of their progeny are inviable, dying as arrested embryos or as necrotic Uncoordinated and Constipated L1 larvae; a small number of animals survive and develop into Dpy, Egl adults with a protruding vulva. At 25C the y228 homozygotes (derived from a heterozygous mother) are Dpy and Egl and have a protruding vulva; progeny from these animals are inviable and die as embryos or L1 larvae. See also WBPaper00002302.
TY2025 yDp14 (X;I); unc-2(e55) X. C. elegans non-Unc hermaphrodite strain. yDp14/+; unc-2 males are 60% inviable. yDp14/yDp14; unc-2 males are dead.
TY2071 him-8(e1489) IV; dpy-3(e27) unc-2(e55) X; yDp16 (X;f). C. elegans non-Unc, somewhat Dpy hermaphrodites. Gives DpyUncs when yDp16 is lost.
TY2137 meDf6 X; yDp13 (X;f). C. elegans meDf6; yDp13 is WT hermaphrodite which is Him. 27% of self-progeny are WT males. yDp13 recombines with X, but such recombination is greatly reduced in an meDf6 background. Maintain by picking L4 hermaphrodites and checking to make sure they give lots of dead eggs and lots of males. [yDp13 XO males with an intact X chromosome are >90% inviable.]
TY2138 meDf6 X; yDp15 (X;f). C. elegans meDf6; yDp15 is WT hermaphrodite which is Him. 23% of self-progeny are WT males. yDp15 recombines with X, but such recombination is greatly reduced in an meDf6 background. Maintain strain by picking L4 hermaphrodites and making sure they give lots of dead eggs and lots of males. [yDp15 XO males with an intact X chromosome are >90% inviable.]
TY2139 mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf13 unc-1(e1598n1201) dpy-3(e27) X. C. elegans Heterozygotes are WT hermphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; yDf13 unc-1 dpy-3), WT males and Dpy males.
TY2173 mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf17 X. C. elegans The hermaphrodites are variable in phenotype, but most are Dpyish (small) and sick. Pick these hermaphrodites to maintain the strain, since healthier animals may have picked up a suppressor mutation or gone polyploid, etc. Strain gives WT males.
TY2175 mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf17/unc-1(e1598n1201) dpy-3(e27) X. C. elegans WT hermaphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; unc-1 dpy-3), Unc hermaphrodites (yDp14; unc-1 dpy-3), DpyTra hermaphrodites (mnDp66/yDp14; yDf17), WT males, Unc males, and Dpy males. There are 2 types of WT hermaphrodites in this strain which are indistinguishable unless you score their offspring: mnDp66/yDp14; him-8; yDf17/unc-1 dpy-3 animals will have many WT males progeny; but mnDp66/yDp14; him-8; unc-1 dpy-3 animals will have primarily dpy male progeny [mnDp66/yDp14; unc-1 dpy-3 XO animals are mostly dead, but there are some escapers of lethality]. Maintain by picking L4 WT hermaphrodites and checking for correct segregation of progeny.
TY2202 yDp14 (X;I); him-8(e1489) IV; yDf20 X. C. elegans
TY2384 sex-1(y263) X. C. elegans Dpy. Egl.
TY2431 him-8(e1489) IV; yIs34 V. C. elegans yIs34 [(pMN15.1) xol-1::GFP + rol-6(su1006)]. Rollers. xol-1::GFP translational fusion with sXO-specific expression. Strain gives some non-Rollers, which represent silenced arrays.
TY2438 yIs33 III. C. elegans yIs33 [xol-1::lacZ + rol-6(su1006)]. Rollers. XO-specific expression of lacZ fusion.
TY2439 yIs33 III; him-8(e1489) IV. C. elegans yIs33 [xol-1::lacZ + rol-6(su1006)]. Rollers. XO-specific expression of lacZ fusion. Not all animals Roll.
TY2685 fox-1(y303) X. C. elegans
TY2782 fox-1(y303) dpy-6(e14) X. C. elegans
TY2788 unc-4(e120) II; yDf19/yDf20 X. C. elegans yDf20 previously known as y288. Internal deletion. Takes out dpy-3 and lin-32. Heterozygotes are Unc.
TY3553 scd-2(y386) V. C. elegans Variably scrawny, Sma, starved-looking, sluggish.
TY3558 unc-119(ed3) ruIs32 III; ojIs1. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Histone and tubulin GFP.
TY3579 sea-1(y356) II. C. elegans Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains.
TY3581 daf-8(e1393) I; scd-2(y386) V. C. elegans Egl. Not temperature sensitive -- can be grown at any temperature.
TY3753 daf-7(e1372) III; cuIs2 IV. C. elegans cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Weak Rollers. Dauer constitutive at higher temperatures. Maintain at 15C.
TY3837 dpy-28(y402)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. C. elegans qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.
TY3856 cuIs5 I. C. elegans cuIs5 [myo-2c:: GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx.
TY3862 daf-7(e1372) III; cuIs5. C. elegans cuIs5 [myo-2c:: GFP + rol-6(su1006)]. Daf-c. Maintain at 15C. Rollers. GFP+ in pharynx. Reference: Reiner DJ, et al. (2008) Current Biology 18(15):1101-9.
TY3886 cuIs5 I; daf-3(e1376) X. C. elegans cuIs5 [myo-2c::GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx.
TY3936 dpy-21(e428) V. C. elegans Dpy. Throws males. Pick L4 hermaphrodites to maintain. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32. TY3936 was derived in 2002 from TY1932 ncl-1(e1865) unc-36(e251); dpy-21(e428) X N2; cloned WT progeny, let self and picked Dpy animals, cloned and selfed, looked for absence of Unc progeny. TY1932 was frozen into TY collection in 1993; built from other strains derived original CB428 stock obtained & frozen in 1983.
TY404 +/szT1 [lon-2(e678)] I; lin-15B&lin-15A(n765) yDf1/szT1 X. C. elegans Heterozygotes are WT and segregate WT, dead eggs, and Lon males. Maintain by picking WT.
TY415 unc-32(e189) dpy-28(s939) III/eT1 III; +/eT1 V. C. elegans WT strain which segregates WT, Unc-36, DpyUnc and dead eggs. DpyUncs give 6-10% viable progeny at 20C and less than 1% at 15C. Maintain by picking WT.
TY418 dpy-21(y47) V. C. elegans Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y47) is a nonsense mutation predicted to terminate translation at codon 1396, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32.
TY4236 him-8(e1489) IV; mIs10 V. C. elegans mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Him. mIs10 suppresses recombination between unc-60 and dpy-11.
TY4381 dpy-28(s939)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. C. elegans qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP s939 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.
TY4851 sup-9(n1012) II. C. elegans Superficially wild-type.
TY4852 sup-9(n1020) II. C. elegans Superficially wild-type.
TY4986 htp-3(y428) ccIs4251 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I,III). C. elegans ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, htp-3(y428) ccIs4251 homozygotes that are GFP+ in body wall muscle but not pharynx, hT2 GFP+ homozygotes, and aneuploid dead embryos. Avoid picking viable aneuploids that often appear larger and longer than wild-type.
TY5038 htp-3(tm3655) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I,III). C. elegans Segregates WT GFP+ heterozygotes, GFP- tm3655 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Avoid picking viable aneuploids that often appear larger and longer than wild-type.
TY5120 +/nT1 IV; coh-4(tm1857) coh-3(gk112) V/nT1 [qIs51] V. C. elegans Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.
TY5121 rec-8(ok978)/nT1 IV; coh-4(tm1857) coh-3(gk112) V/nT1 [qIs51] V. C. elegans Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile rec-8(ok978); coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.
TY525 him-8(e1489) IV; xol-1(y9) X. C. elegans Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf).
TY562 +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf3/szT1 X. C. elegans Unc. Throws Unc, UncLon males and dead eggs.
TY5640 Ppa-unc-119(y566). Pristionchus pacificus Pristionchus pacificus. Ppa-unc-119(y566). Reference: Lo TW, et al. Genetics. 2013 Oct;195(2):331-48.
TY567 +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf2/szT1 X. C. elegans Unc. Throws Unc, UncLon males and dead eggs.
TY5684 sdc-2(y93) X. C. elegans Temperature-sensitive. Maintain at 15C. Complements other sdc-2 alleles at 15C. At 20C animals are not Dpy or Tra, but there is a low penetrance of lethality, some Egl animals, and some animals will Bag after a couple days of egg-laying. y93 fails to complement other sdc-2 alleles at 25C; homozygotes are Egl,Tra and weakly Dpy at higher temperatures. Shifting embryos (prepared from non-Dpy non-Egl non-Tra gravid adults at 20C) from 20C to 25C is sufficient to alter their phenotype. Reference: Nusbaum C & Meyer BJ. Genetics. 1989 Jul;122(3):579-93.
TY574 dpy-21(y59) V. C. elegans Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y59) is a nonsense mutation predicted to terminate translation at codon 417, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32.
TY5755 xol-1(y684) X. C. elegans Male lethal. y684 is s a null allele caused by precise deletion of the coding sequence of xol-1. Reference: Anderson EC, et al. Dev Cell. 2019 Oct 21;51(2):192-207.e6.
TY578 +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf5/szT1 X. C. elegans Unc. Throws Unc, UncLon males and dead eggs.
TY714 +/szT1 [lon-2(e678)] I; sdc-2(y46)/szT1 X. C. elegans Heterozygotes are WT.
TY788 lin-15B&lin-15A(n765) sup-10(n983) X. C. elegans Animals are Muv and Unc at 20C and 25C. At 15C the animals are Unc. Temperature sensitive Muv phenotype. See also WBPaper00001990.
TY824 +/szT1 [lon-2(e678)] I; sdc-2(y74)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Lon males, and dead eggs. sdc-2(y74)/sdc-2(y74) is lethal, although about 3% of the animals escape the lethality. These animals are extremely Dpy, extensively masculinized, and never fertile.
TY832 yDf4/dpy-11(e224) unc-76(e911) V. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
TY873 yDf6/unc-76(e911) V. C. elegans Heterozygotes are WT and segregate WT, Unc, and dead eggs. Maintain by picking WT.
TY903 yDf7/unc-76(e911) V. C. elegans Heterozygotes are WT and segregate WT, Unc and dead eggs. Maintain by picking WT.
TY956 sdc-3(y132)/unc-76(e911) V. C. elegans Heterozygotes are WT and segregate WT, Unc and Dpy (sdc-3/sdc-3). sdc-3 homozygotes exhibit a strong maternal effect lethality->most progeny from homozygotes arrest as L1 larvae--about 14% escape the lethality and develop into Dpy, Egl hermaphrodites.
VT191 +/szT1 [lon-2(e678)] I; dpy-6(e14) lin-14(n536) maDf1/szT1 X. C. elegans
VT192 +/szT1 [lon-2(e678)] I; dpy-6(e14) lin-14(n536) maDf2/szT1 X. C. elegans

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
y52 Allele substitution
y180 Allele
y101 Allele
y1 Allele substitution
y9 Allele
y56 Allele
y70 Allele
y250 Allele substitution
y251 Allele substitution
WBVar00275318 Naturally occurring
y128 Allele substitution
y226 Allele
y228 Allele
y263 Allele substitution splice_site
y303 Allele
y386 Allele deletion
y356 Allele substitution nonsense
y402 Allele deletion
y47 Allele substitution nonsense
y428 Allele substitution nonsense
y93 Allele
y59 Allele substitution nonsense
y46 Allele
y74 Allele
y132 Allele deletion frameshift