Laboratory Information

NameTQ View on WormBase
Allele designationxu
HeadShawn Xu
InstitutionUniversity of Michigan, Ann Arbor, MI
Address Life Sciences Institute, Rm 6239
University of Michigan
210 Washtenaw Ave.
Ann Arbor 48109
United States
Website http://www.lsi.umich.edu/labs/shawn-xu-lab
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
OP50(xu363) E. coli [ura-, strR, rnc-, (delta)attB::FRT-lacI-lacUV5p-T7). Escherichia coli Bacteria. RNAi-compatible OP50 strain. Slow growing. When growing this strain, pick single colonies for liquid culture (at least 20 hrs) from a freshly streaked tetracycline LB plate. Do not include tetracycline in liquid culture, as Tet in liquid culture can have long lasting effects on worm lifespan. The authors recommend using standard PEG transformation method to make competent OP50(xu363) cells, but other ways to make competent cells will also likely work for OP50(xu363). Reference: Xiao R, et al. Cell Rep. 2015 May 19;11(7):1123-33.
OP50-tdTomato E. coli Escherichia coli Bacteria. A22 tdTomato-expressing OP50. Amp Resistant. tdTomato coding sequence was cloned into pGEX-5x-3 vector and transformed into OP50 component cells. Reference: Zhang B, et al. Nat Aging 2021 1, 255–268. https://doi.org/10.1038/s43587-021-00039-1.
TQ10515 seld-1(xu408) IV. C. elegans seld-1(xu408) is a G314E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10516 scbp-2(xu418) I. C. elegans scbp-2(xu418) is a G47R missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10517 gspd-1(xu416) IV. C. elegans gspd-1(xu416) is a E375K missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10518 gspd-1(xu409) IV. C. elegans gspd-1(xu409) is a L369F missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10519 gsr-1(xu413) III. C. elegans gsr-1(xu413) is a S21F missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10520 seld-1(xu415) IV. C. elegans seld-1(xu415) is a G170E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10521 gsr-1(xu414) III. C. elegans gsr-1(xu414) is a G279E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10548 trxr-1(xu421) IV. C. elegans trxr-1(xu421) is a W275* nonsense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ1101 lite-1(xu7) X. C. elegans Defective phototaxis (light avoidance). To identify lite-1(xu7) homozygotes, place day 1 adults on a freshly seeded NGM plate witha thin lawn of OP50. Deliver 2 second pulses of short wavelength light (UV, purple, blue) from an arc lamp to the head of a worm that is slowly moving forward through a 5-10x objective lens in conjunction with a room lens under a fluorescent dissection scope. Manually move the plate so only the anterior of the worm appears in the field of view. Wild-type worms respond by initiating reversals while homozygous mutants do not. Maintain under normal conditions. Reference: Liu J, et al (2010) Nature Neurosci 13:715-22.
TQ1828 pde-1(nj57) pde-5(nj49) I; pde-3(nj59) II; pde-2(tm3098) III. C. elegans Maintain under normal conditions. Reference: Liu J, et al (2010) Nature Neurosci 13:715-22.
TQ194 trp-2(sy691) III. C. elegans
TQ2183 lite-1(xu7) X; xuEx705. C. elegans xuEx705 [npr-9p::GCaMP3.0 + npr-9::DsRed2B]. Superficially wild-type. Maintain by picking red fluorescent animals; DsRed might not be visible at lower magnifications. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.
TQ225 trp-1(sy690) III. C. elegans
TQ233 trpa-1(ok999) IV. C. elegans Shorter lifespan than wild-type worms at 15-20 C, but not at 25 C. Reference: Xiao R, et al. Cell. 2013 Feb 14;152(4):806-17.
TQ296 trp-4(sy695) I. C. elegans
TQ3032 lite-1(xu7) X; xuEx1040. C. elegans xuEx1040 [nmr-1p::G-CaMP3.0 + nmr-1p::DsRed]. Pick fluorescent animals to maintain. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.
TQ8245 lite-1(xu492) X. C.elegans Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5’ CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5’ GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5’ GAAGCAACAAGACGATCTCC; Forward (internal): 5’ ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
xu7 Allele substitution