Laboratory Information

NameTOG View on WormBase
Allele designationogr
HeadTarou Ogurusu
InstitutionIwate University
Address 4 Ueda
Morioka 020-8551
Japan
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
TOG1 mfsd-6(ogr1) III. C. elegans Slow growth, Slow movement. ogr1 is a 1.2 kb deletion causing a frameshift at residue 54 and premature stop at residue 83. Reference: Ogurusu T, et al. Biochem Biophys Res Commun. 2015 Aug 7;463(4):994-8. PMID: 26079877
TOG2 T09F3.2(ogr2) II. C. elegans Slow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt
TOG3 Y74C10AL.2(ogr3) I. C. elegans Short-lived at 25C. Sensitive to paraquat. ogr3 is a 1238 bp deletion; flanking sequences: aaaattttttaaaaaaatat - taaaatcttccaacaaaaaaa
This laboratory hasn't submitted any alleles to the CGC.