Laboratory Information
Name | TOG View on WormBase |
---|---|
Allele designation | ogr |
Head | Tarou Ogurusu |
Institution | Iwate University |
Address | 4 Ueda Morioka 020-8551 Japan |
Gene classes |
Strains contributed by this laboratory
Strain | Genotype | Species | Description |
---|---|---|---|
TOG1 | mfsd-6(ogr1) III. | C. elegans | Slow growth, Slow movement. ogr1 is a 1.2 kb deletion causing a frameshift at residue 54 and premature stop at residue 83. Reference: Ogurusu T, et al. Biochem Biophys Res Commun. 2015 Aug 7;463(4):994-8. PMID: 26079877 |
TOG2 | T09F3.2(ogr2) II. | C. elegans | Slow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt |
TOG3 | Y74C10AL.2(ogr3) I. | C. elegans | Short-lived at 25C. Sensitive to paraquat. ogr3 is a 1238 bp deletion; flanking sequences: aaaattttttaaaaaaatat - taaaatcttccaacaaaaaaa |
This laboratory hasn't submitted any alleles to the CGC.